ID: 1057848893

View in Genome Browser
Species Human (GRCh38)
Location 9:98549239-98549261
Sequence CAAAACATGGAAAAGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 818}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057848893_1057848895 -10 Left 1057848893 9:98549239-98549261 CCTGGCTTCTTTTCCATGTTTTG 0: 1
1: 0
2: 5
3: 97
4: 818
Right 1057848895 9:98549252-98549274 CCATGTTTTGATAGTTTCAAAGG No data
1057848893_1057848897 15 Left 1057848893 9:98549239-98549261 CCTGGCTTCTTTTCCATGTTTTG 0: 1
1: 0
2: 5
3: 97
4: 818
Right 1057848897 9:98549277-98549299 AGCTAAAAAAATGTTTTATTGGG No data
1057848893_1057848896 14 Left 1057848893 9:98549239-98549261 CCTGGCTTCTTTTCCATGTTTTG 0: 1
1: 0
2: 5
3: 97
4: 818
Right 1057848896 9:98549276-98549298 AAGCTAAAAAAATGTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057848893 Original CRISPR CAAAACATGGAAAAGAAGCC AGG (reversed) Intronic
900814559 1:4833464-4833486 CGTATCATGGACAAGAAGCCTGG - Intergenic
901568216 1:10136756-10136778 CTAAAAATGCAAAAGTAGCCAGG + Intronic
901603553 1:10441473-10441495 CAAAACATACAAAAATAGCCGGG - Intronic
902314383 1:15606880-15606902 TAAAAAATACAAAAGAAGCCGGG + Intergenic
902454385 1:16521433-16521455 CAAAAGCTGGGAAAGAAGCCGGG + Intergenic
902498067 1:16888884-16888906 CAAAAGCTGGGAAAGAAGCCCGG - Intronic
902959370 1:19951633-19951655 GAAAAAATGAAAAAGAAGGCTGG + Intergenic
903075903 1:20765994-20766016 CAAAACAAGAAAAAGGAGCCAGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903415749 1:23181780-23181802 CAAAAATTGGAACAGAGGCCAGG + Intergenic
903473515 1:23603970-23603992 GAAATCATGAAAAACAAGCCTGG + Intronic
903530920 1:24029784-24029806 CAAAAATTTGAAAATAAGCCAGG - Intergenic
903635731 1:24813877-24813899 CAAAACATAAAAAATTAGCCAGG - Intronic
903996706 1:27309790-27309812 AAAAACATAAAAAATAAGCCAGG - Intergenic
904191141 1:28744827-28744849 AAAAACATGAAAAACTAGCCGGG - Intronic
904516188 1:31057240-31057262 CAAAAAATACAAAAGTAGCCGGG + Intronic
905077941 1:35290588-35290610 CAAAAAATGAAAAATGAGCCAGG - Intronic
905550858 1:38837544-38837566 CAAAATCTGAAAAAGAAGACAGG + Intergenic
905780026 1:40700639-40700661 CAAAAAATAAAAAATAAGCCAGG - Intronic
906072926 1:43030529-43030551 AAAAAAAAAGAAAAGAAGCCAGG - Intergenic
906575905 1:46889307-46889329 CAAATCATGTAAAAGAAACAAGG + Intergenic
906596068 1:47078587-47078609 CAAATCATGTAAAAGAAACAAGG - Intronic
906834011 1:49063370-49063392 AAAAACATGGCAAAGAGGTCGGG + Intronic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
907350283 1:53824071-53824093 CAAAAAATACAAAAGTAGCCAGG + Intronic
908804789 1:67919012-67919034 CAAAACACGAAAAATTAGCCGGG + Intergenic
909474114 1:76062904-76062926 CAAAACATGTCCAAGAGGCCGGG + Intergenic
909573528 1:77146498-77146520 AAAAAAATGTAAAAGAGGCCTGG + Intronic
909662297 1:78097591-78097613 TAAAATATGGAAATGAAGGCAGG - Intronic
909829710 1:80172496-80172518 TAAACAATGGCAAAGAAGCCAGG - Intergenic
909886275 1:80945919-80945941 TAAAAAATGAAAAAGAAGACAGG + Intergenic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
910847752 1:91619644-91619666 CTAACCATGGAAAAGAAGGTGGG + Intergenic
911209652 1:95125994-95126016 AAAAAAAAGGAAAAGAGGCCAGG + Intronic
912209034 1:107538329-107538351 CAAAACATAGAAATTAGGCCAGG - Intergenic
912274077 1:108238498-108238520 AAAAACATGAAAAACTAGCCAGG - Intronic
912287190 1:108381364-108381386 AAAAACATGAAAAACTAGCCAGG + Intronic
912294142 1:108455825-108455847 AAAAACATGAAAAACTAGCCAGG + Intronic
912883905 1:113448822-113448844 TAAAACATAAAAAAGAGGCCGGG + Intronic
912983915 1:114406361-114406383 TAAAAAAGGAAAAAGAAGCCCGG + Intronic
913557197 1:119979317-119979339 CAACAAATGAAAAAGAAGGCAGG + Intronic
913600661 1:120418709-120418731 CAAAAAATAGAAAATTAGCCGGG - Intergenic
913655176 1:120953095-120953117 CAAAAGCTGGAAAAGAAGCAGGG + Intergenic
913698680 1:121353344-121353366 CAAAAAATAAAAAATAAGCCAGG - Intronic
914004298 1:143718883-143718905 CAAAAGCAGGAAAAGAAGCTAGG - Intergenic
914006532 1:143736769-143736791 CAAAAGCTGGGAAAGAAGCCAGG + Intergenic
914081994 1:144418462-144418484 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914086394 1:144457924-144457946 CAAAAAATAGAAAATTAGCCGGG + Intronic
914095465 1:144540643-144540665 CAAAAGCGGGGAAAGAAGCCGGG + Intergenic
914099110 1:144568367-144568389 CAAAAGCGGGGAAAGAAGCCGGG + Intergenic
914138867 1:144926691-144926713 CAAAAAATAAAAAATAAGCCAGG + Intronic
914176901 1:145286962-145286984 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914192290 1:145421875-145421897 CAAAAAATAGAAAATTAGCCGGG + Intergenic
914299877 1:146369297-146369319 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914303060 1:146393250-146393272 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914313482 1:146487430-146487452 CAAAAGCGGGGAAAGAAGCCGGG + Intergenic
914500866 1:148245951-148245973 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914531629 1:148528454-148528476 CAAAAGCGGGGAAAGAAGCCGGG - Intergenic
914590196 1:149099819-149099841 CAAAAAATAGAAAATTAGCCGGG + Intronic
914636762 1:149559275-149559297 CAAAAGCGGGGAAAGAAGCCGGG + Intergenic
914645361 1:149647256-149647278 CAAAAGCTGGAAAAGAAGCAGGG + Intergenic
914692260 1:150041003-150041025 TAAAAAAAGGAAAAGAGGCCAGG - Intergenic
914752508 1:150545087-150545109 CTAAAAATAGAAAAGTAGCCAGG - Intergenic
915015001 1:152724685-152724707 CAAAACATGGAATGAAACCCCGG + Intergenic
915206130 1:154271749-154271771 CAAAAAATACAAAAGTAGCCGGG + Intergenic
915281432 1:154825014-154825036 GAAAACATGTCAAAGAAGTCTGG + Intronic
915978637 1:160406887-160406909 CAAAAAATGCAAAATTAGCCAGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916573886 1:166050490-166050512 CTAAAGATGGAAAAGACACCAGG - Intergenic
916669039 1:166995398-166995420 CAAAAAATACAAAAGTAGCCGGG - Intronic
917754899 1:178089232-178089254 CAAAAAATGCAAAATTAGCCAGG + Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918696170 1:187549315-187549337 CAAAACAGGGTAAAGAAGGGTGG - Intergenic
919215344 1:194546419-194546441 CAAAAAATTGAAAAGAACACAGG - Intergenic
919229438 1:194754597-194754619 TAGAAAATGAAAAAGAAGCCGGG + Intergenic
919432698 1:197516610-197516632 CAACACAGGGAAAAAAGGCCTGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
920486086 1:206371981-206372003 CAAAAAATAAAAAATAAGCCAGG - Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
921091728 1:211849850-211849872 CAAAAAGGTGAAAAGAAGCCAGG - Intergenic
923826273 1:237504001-237504023 TAAAACATAGAATAGAGGCCAGG - Intronic
923896763 1:238278506-238278528 CAAAAAATAGAAAATTAGCCAGG + Intergenic
924199278 1:241642103-241642125 CAAAAAATAGAAAATTAGCCAGG + Intronic
924556587 1:245124078-245124100 CAAGAGATGGTAAAGAAACCTGG - Intronic
924912083 1:248524312-248524334 AAAACGAGGGAAAAGAAGCCTGG + Intergenic
1062967862 10:1624071-1624093 AAAAACATGAAAAATTAGCCTGG + Intronic
1063370340 10:5517343-5517365 CAAAACAGACAACAGAAGCCAGG - Intergenic
1063411066 10:5836819-5836841 CAAAACAACAAAAAAAAGCCAGG - Intronic
1063942493 10:11144729-11144751 CAAAACATAAAAAATCAGCCAGG + Intronic
1064056676 10:12103674-12103696 CAAAATATTTAAAAGTAGCCAGG - Intronic
1064545294 10:16444286-16444308 CAAAAAAAAGAAAAGAGGCCGGG - Intronic
1064766099 10:18673353-18673375 AAAAACATGGAATACAGGCCAGG - Intronic
1065011295 10:21423275-21423297 CAAAACATAAAAAATTAGCCAGG + Intergenic
1065574125 10:27101279-27101301 CAAAAAATGCAAAAATAGCCGGG - Intergenic
1065576928 10:27130273-27130295 CAAGACAGAGAAGAGAAGCCAGG - Intronic
1065706729 10:28477487-28477509 CAAAAAAACAAAAAGAAGCCAGG + Intergenic
1065792390 10:29273037-29273059 TAAAATATGGAAGAGAGGCCAGG + Intergenic
1066382063 10:34910451-34910473 CAAAACATTGCAGAGCAGCCCGG + Intergenic
1067094111 10:43287016-43287038 CAAAAAATTAAAAAGTAGCCTGG + Intergenic
1067698959 10:48555142-48555164 CAATACCTGGAAATAAAGCCAGG - Intronic
1067729076 10:48796069-48796091 GGAAACATGGAAAAGATGCAGGG + Intronic
1067976247 10:51028559-51028581 GAAGACAGGGAAGAGAAGCCAGG + Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1069249860 10:66254857-66254879 TCAAAAATGGAAAAGAACCCTGG - Intronic
1070246479 10:74737191-74737213 CTAAAAATGCAAAAGTAGCCTGG - Intergenic
1070429461 10:76322412-76322434 CACATCATGGAAAATAATCCAGG - Intronic
1070628434 10:78067649-78067671 TAAAACATGCAAAAAAAGCAAGG + Intergenic
1071772583 10:88745633-88745655 CTAAACATGGAAATAAAGACTGG + Intronic
1072128550 10:92469587-92469609 CAAAAAATTGAAAAACAGCCAGG - Intronic
1073277816 10:102327873-102327895 CAAAACATGGGACAGAAGCTGGG - Intronic
1073658002 10:105438377-105438399 CAAAAAAGTGAAAAAAAGCCTGG + Intergenic
1073665078 10:105522567-105522589 CCAAACATGGAAAAGAAGAAGGG + Intergenic
1073806233 10:107101340-107101362 CAAAACATGAAAAAATAGACCGG - Intronic
1073843505 10:107525901-107525923 AAAAACATGAAAAATTAGCCAGG - Intergenic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075115076 10:119619448-119619470 CAATGCTTGGCAAAGAAGCCAGG - Intergenic
1075150687 10:119927510-119927532 TATGACATAGAAAAGAAGCCTGG - Intronic
1075257088 10:120933936-120933958 TAAAGCATGGAAGAGAAGCAAGG - Intergenic
1075439174 10:122465859-122465881 TAAAACATGGACAAGAAGCCAGG + Intronic
1075756772 10:124818487-124818509 CAAAAAATGGAATGGAAACCAGG + Intronic
1075772345 10:124950283-124950305 CAAAAAATGCAAAATTAGCCAGG - Intronic
1076381346 10:130026458-130026480 CAAAATATACAAAAGGAGCCAGG + Intergenic
1077258487 11:1601714-1601736 CTAATGATGGAAAAGGAGCCAGG + Intergenic
1077885810 11:6386924-6386946 CAAAATATGGCAAAGTGGCCGGG + Intergenic
1078639499 11:13081899-13081921 CAACCCATGGAAAAGAAGGCAGG - Intergenic
1078647268 11:13152368-13152390 GAAGAGCTGGAAAAGAAGCCAGG - Intergenic
1078768663 11:14325592-14325614 AAAAATATTGAAAGGAAGCCGGG - Intronic
1078797350 11:14605680-14605702 AAAAATAGGCAAAAGAAGCCAGG - Intronic
1078798728 11:14621416-14621438 CAAAACATTGAAAATTAGCTGGG - Intronic
1079461128 11:20678922-20678944 TAAAAAATGGATAAAAAGCCTGG + Intronic
1079796966 11:24816034-24816056 CCAATCATGCAAAAGTAGCCGGG - Intronic
1080029511 11:27646169-27646191 GAAAACACGGGGAAGAAGCCAGG + Intergenic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1082192872 11:49268373-49268395 AAAAAGATGGGAAAGAAGACGGG + Intergenic
1083466501 11:62850362-62850384 AAAAACAAAGAAAAGCAGCCAGG + Intergenic
1084139031 11:67211316-67211338 CAAAATATAGAAAATAAGCCAGG + Intronic
1084294503 11:68202840-68202862 CAAAACATGGAAATAAAGCCAGG - Intronic
1084627606 11:70320596-70320618 CAAAACATAAAAAATTAGCCGGG - Intronic
1084762171 11:71280867-71280889 CTAAACATGCAAAATAAGCCGGG + Intergenic
1084796271 11:71506581-71506603 CTAATCAGGGAAAAGGAGCCAGG + Intronic
1084803038 11:71558273-71558295 CTAATGATGGAAAAGGAGCCAGG - Intronic
1085190930 11:74621719-74621741 ATAAATATGGAAAAAAAGCCAGG + Intronic
1085441036 11:76562434-76562456 CAGAAGATGGGAAAGAAGCAGGG + Intergenic
1085719061 11:78897291-78897313 CAGCAAAGGGAAAAGAAGCCTGG - Intronic
1085801659 11:79595406-79595428 AAAAAAGTGGAAAAGAAGACAGG - Intergenic
1087401359 11:97670456-97670478 AAAAACATGCTGAAGAAGCCAGG - Intergenic
1087491531 11:98833647-98833669 CTAAAAATGAAAAAGTAGCCAGG - Intergenic
1087567828 11:99884985-99885007 CAAAACAGGGAGAAAAATCCAGG + Intronic
1088170271 11:106988391-106988413 TAAAACATGGAACAGAAAGCAGG + Intronic
1088266669 11:107994016-107994038 CAAAAAAAGGAAAAAAGGCCAGG - Intergenic
1088546817 11:110967546-110967568 CAAAAAATAGAAAATTAGCCGGG - Intergenic
1089305820 11:117525453-117525475 CAAAAAAAAAAAAAGAAGCCAGG - Intronic
1089348128 11:117804767-117804789 AAAAACATTTAAAAGTAGCCAGG + Intronic
1089570509 11:119405532-119405554 AAAAACATACAAAAGTAGCCAGG - Intergenic
1089627831 11:119762689-119762711 CAAACCATGAAATAGAAGCATGG - Intergenic
1089720275 11:120411940-120411962 CTAAAAATGGCTAAGAAGCCAGG - Intronic
1090067122 11:123512554-123512576 CAAAAAATGAAAAATTAGCCAGG + Intergenic
1090625377 11:128603714-128603736 CAAAATATGGGAAAGGAGCTGGG + Intergenic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1091521424 12:1247833-1247855 CTAAAAATAGAAAAGTAGCCGGG + Intronic
1092133328 12:6127836-6127858 GAAAAAATGGAAGAGCAGCCAGG + Intergenic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092406646 12:8226202-8226224 AAAAAGATGGAAAAGAAGACAGG - Intronic
1092549219 12:9479454-9479476 CAAAAAATGCAAAATTAGCCAGG + Intergenic
1093031221 12:14290778-14290800 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1093410219 12:18856388-18856410 TAAAACATGGAAAAAAGGCCCGG + Intergenic
1093673621 12:21907074-21907096 CAAAACATTGAACAAAAACCAGG - Intronic
1094557758 12:31519068-31519090 CAAAGCACAGAAAAGAAGCTAGG - Intronic
1094576872 12:31694583-31694605 CAAAAAATAAAAAAGTAGCCAGG + Intronic
1094659868 12:32458952-32458974 CAATAGTTAGAAAAGAAGCCAGG + Intronic
1095451646 12:42337589-42337611 CAAAAAAAAGAAAAGAGGCCAGG - Intronic
1095877276 12:47094842-47094864 AAAAACATGGAAATGAAGGAAGG - Intronic
1095969330 12:47891006-47891028 GAAAATAAGGAAAATAAGCCTGG - Intronic
1096232946 12:49907008-49907030 CAAAAATAGGAAAAGTAGCCAGG - Intergenic
1096254320 12:50053624-50053646 CGAAGCATGGAGAAGAAGCTGGG + Intergenic
1096300964 12:50426897-50426919 CAAAACATACAAAATTAGCCAGG - Intronic
1097028877 12:56077755-56077777 CAAAAAAAGGAAAAAAAGCCAGG + Intergenic
1097197254 12:57249909-57249931 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1097524135 12:60709298-60709320 AAAAACAAAGAAAAGAAGTCAGG - Intergenic
1097996235 12:65890882-65890904 CAAAAAATGCAAAAAAAGCCGGG - Intronic
1098011310 12:66055677-66055699 AAAAATATGAAAAAGTAGCCCGG - Intergenic
1098537723 12:71613651-71613673 CAGAACACTGACAAGAAGCCAGG + Intronic
1098843031 12:75500287-75500309 CAAAATATGGAAAAGAATGTAGG - Exonic
1098890149 12:76001989-76002011 TAAAAAATAGAAAATAAGCCAGG + Intergenic
1099222449 12:79931375-79931397 CAAAAAATGGAAATGAGGCTTGG + Intronic
1099620796 12:85000717-85000739 AAAAACATGAAAGAGAAGACAGG - Intergenic
1099642492 12:85310046-85310068 CAAGACATAGATAAAAAGCCTGG - Intergenic
1101076672 12:101136891-101136913 CAAAGCAAAGAAATGAAGCCAGG + Intergenic
1101230255 12:102733580-102733602 CTAAAAATACAAAAGAAGCCAGG + Intergenic
1101375158 12:104165177-104165199 CAAAACATACAAAATTAGCCGGG - Intergenic
1101881902 12:108631408-108631430 CAAAAAATTTAAAAGTAGCCGGG - Intronic
1102041254 12:109802288-109802310 AAAAAGATGCAAAAAAAGCCAGG - Intronic
1102527758 12:113524216-113524238 CAAAAGTTGGCAAACAAGCCAGG - Intergenic
1102915178 12:116747215-116747237 CAAAAAATTAAAAAGTAGCCAGG - Intronic
1103350935 12:120283120-120283142 AAAAATACGGAAAAGTAGCCGGG + Intergenic
1103472665 12:121194328-121194350 CAAAACATAAAAAATTAGCCAGG - Intergenic
1103616551 12:122156745-122156767 CAAAACACAAAAAAGAGGCCGGG + Intergenic
1104046675 12:125168136-125168158 CCAAACATGGCAAAGAAGGATGG + Intergenic
1104089438 12:125502923-125502945 CAGAACATCAAAAAGAAGCCAGG - Intronic
1104421796 12:128642096-128642118 CAAAAAATGGGAAATAAGCTGGG - Intronic
1104683128 12:130765964-130765986 CACACCAAGGGAAAGAAGCCAGG + Intergenic
1105047970 12:133021921-133021943 CAAATCATTAAAAAGAGGCCAGG + Exonic
1105445904 13:20456915-20456937 CAAAGCAGGGCAAAGAAGCGTGG - Intronic
1105520808 13:21129261-21129283 AAAAATATGAAAAAGTAGCCAGG - Intergenic
1106697141 13:32187505-32187527 CAAGACATGGAAATGAAACTTGG - Intronic
1107403444 13:40091425-40091447 CAAAAGATGGAAAAGATGGTGGG + Intergenic
1107591398 13:41910422-41910444 AAAAACATGAAAAATTAGCCGGG + Intronic
1107833343 13:44393684-44393706 CAAAAGAGGGAAAGGAAGCGGGG - Intronic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1108709669 13:53020292-53020314 CAAAATATTAAAAAGTAGCCAGG - Intergenic
1108986672 13:56598053-56598075 CAAAAAATGGAAAGGAAGCTAGG - Intergenic
1109802279 13:67396554-67396576 CAGAACATGCAAAAAATGCCAGG + Intergenic
1109835646 13:67852748-67852770 CAAAATAAGGAAAAAAAGACTGG + Intergenic
1110596075 13:77321997-77322019 CAAAAAATAAAAAACAAGCCAGG + Intronic
1110675357 13:78236499-78236521 CTAAATATGGAAAACATGCCTGG + Intergenic
1110788692 13:79562851-79562873 CAACAAATGGAAAACAAGCAGGG + Intergenic
1110856549 13:80303163-80303185 GAAAAAATGGAAACGAAGCGTGG - Intergenic
1111401572 13:87743584-87743606 CAAAACAGGGAAAATAACCAAGG - Intergenic
1111489967 13:88959512-88959534 CAGAACATGGGAAAGAGGCTGGG + Intergenic
1111585449 13:90277974-90277996 CAAATCATGGAAATTAAGCCTGG - Intergenic
1111833758 13:93361650-93361672 AATAAGATGGAAAAGAATCCTGG + Intronic
1111859423 13:93682855-93682877 AAAAAAAGGGAAAAGTAGCCAGG + Intronic
1111932461 13:94525829-94525851 CAAAACATAAAAAATTAGCCAGG + Intergenic
1112044323 13:95580493-95580515 CAAAACATGGAATAGAGACCTGG + Exonic
1112343643 13:98572798-98572820 CAAAACATGGTAAATTAACCAGG + Intronic
1112641076 13:101275723-101275745 CACAAAAAGGAAAAGAAACCAGG + Intronic
1113111053 13:106823963-106823985 TAAAACATGAAGAAGAGGCCGGG - Intergenic
1113348906 13:109508769-109508791 TAAAGAAAGGAAAAGAAGCCGGG - Intergenic
1114173060 14:20293927-20293949 CAACACTTGGAAATGAAGCTTGG + Intronic
1114274020 14:21125520-21125542 CAAAACTATAAAAAGAAGCCAGG + Intergenic
1114352611 14:21869932-21869954 CAAAACATGAAAATGAGGCAGGG - Intergenic
1114619923 14:24089405-24089427 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1114971049 14:28029130-28029152 CTAAAAATGCAAAATAAGCCAGG - Intergenic
1115093145 14:29602588-29602610 CAAAACATACAAAATTAGCCAGG - Intronic
1115258756 14:31431168-31431190 AAAAAAATGCAAAAGAGGCCGGG + Intronic
1116677902 14:47928818-47928840 CTAAAAATGGAAAATAAGCAAGG - Intergenic
1116869680 14:50059615-50059637 GAGAACATGGAAAAGAATCCTGG + Intergenic
1117017862 14:51536710-51536732 AAAAATATGGACAAGAGGCCAGG - Intronic
1117028475 14:51646021-51646043 CAAAACACTGAAGAGAGGCCGGG + Intronic
1117084055 14:52181059-52181081 CTTAACATGGGAAAGCAGCCAGG - Intergenic
1117535209 14:56696595-56696617 CAAAAAACAGAAAAAAAGCCAGG - Intronic
1117670189 14:58098688-58098710 CAAACAATGGCAAAGAAGCCTGG + Intronic
1117730842 14:58720233-58720255 AAAAACATAGAAAATTAGCCAGG + Intergenic
1118016905 14:61670031-61670053 AAAAACACAGAAAAGTAGCCAGG + Intergenic
1119684688 14:76622303-76622325 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1119720547 14:76887229-76887251 CAGAACACAGAAATGAAGCCAGG + Intergenic
1120361431 14:83508059-83508081 CAAATAACAGAAAAGAAGCCAGG - Intergenic
1120751156 14:88199498-88199520 AAGAACCTGGAAAAGCAGCCAGG + Intronic
1121492223 14:94368841-94368863 CAGAGCCTGGAAGAGAAGCCAGG - Intergenic
1121556355 14:94840772-94840794 CAAAGCATGGAAAAGAAATTGGG + Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122586952 14:102814816-102814838 CAAGAAATTGAAAAGAGGCCAGG - Intronic
1122752171 14:103944858-103944880 GGAAAAAGGGAAAAGAAGCCGGG - Intronic
1123629623 15:22252785-22252807 AAAAACATAGAAAATTAGCCAGG + Intergenic
1123674640 15:22698187-22698209 CTAAAAATGGAAAAAAGGCCGGG + Intergenic
1123685147 15:22791870-22791892 AAAAGCATGGCAAAGAAGGCAGG - Intronic
1123685161 15:22791945-22791967 AAAAGCATGGCAAAGAAGGCAGG - Intronic
1124163289 15:27294509-27294531 CAAGACTGGGAAAAGAGGCCAGG - Intronic
1124194439 15:27608828-27608850 CACAACATGGAAAACGACCCTGG + Intergenic
1124326653 15:28771168-28771190 CTAAAAATGGAAAAAAGGCCAGG + Intergenic
1124384221 15:29193110-29193132 TAAAACAGGGAAAAGAAGTAAGG + Intronic
1124909751 15:33907461-33907483 AAAAATATGGAACAGAAGGCTGG - Intronic
1125358972 15:38846183-38846205 CAAAAGATGAAAAATTAGCCAGG - Intergenic
1125408029 15:39373721-39373743 CAAAACAAAGCAAAGAAGACAGG + Intergenic
1125642942 15:41246887-41246909 CAAAAAATTAAAAAAAAGCCCGG + Intronic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1126138955 15:45420696-45420718 AAAAAAAAAGAAAAGAAGCCAGG + Intronic
1126635271 15:50773825-50773847 TAAAATGTGGTAAAGAAGCCAGG - Intergenic
1126733231 15:51705853-51705875 TAAAACATTAAAAAGAAGGCAGG + Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127411320 15:58709985-58710007 AAAAACATGTAAAATAGGCCAGG + Intronic
1128012438 15:64310709-64310731 AAAAAAAAGGAAAAGAGGCCGGG + Intronic
1128631162 15:69268973-69268995 AAAAACTCGGAAAAGAAGCAAGG + Exonic
1128661197 15:69502221-69502243 CAAAAAATAAAAAAGAGGCCGGG - Intergenic
1128932816 15:71720732-71720754 CCAGAAATGGCAAAGAAGCCAGG + Intronic
1130002094 15:80056805-80056827 CAAAACAGGCAAAACTAGCCAGG + Intergenic
1130666115 15:85871525-85871547 CAATAAAAGGGAAAGAAGCCGGG - Intergenic
1130700220 15:86171539-86171561 CAATTCATCCAAAAGAAGCCAGG + Intronic
1131842331 15:96450530-96450552 GAAAACATGGAATGGAAGGCAGG + Intergenic
1131920782 15:97326125-97326147 CTACACAGGGAAAAGAATCCTGG - Intergenic
1132459003 16:40698-40720 CTAAACATACAAAATAAGCCAGG + Intergenic
1132507717 16:320205-320227 TAAAAAATGAAAAAGTAGCCAGG - Intronic
1133134485 16:3700326-3700348 CAAAAAATGCAAAATTAGCCAGG - Intronic
1133134593 16:3701390-3701412 CAAAAAATAAAACAGAAGCCGGG + Intronic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133947304 16:10359780-10359802 CAAAAAGTAAAAAAGAAGCCAGG + Intronic
1134420596 16:14084377-14084399 CAAAACATGCAAAATTAGCTGGG + Intronic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135136482 16:19888605-19888627 CAAAACATTAAAAATTAGCCAGG + Intergenic
1135292416 16:21251264-21251286 TAAAACATACAAAATAAGCCAGG - Exonic
1135435996 16:22427139-22427161 CAAAAAATACAAAAGTAGCCAGG - Intronic
1135592617 16:23715103-23715125 CAAAAAATAAAAAATAAGCCAGG + Intergenic
1135811383 16:25589834-25589856 AAAAACATAAAAAAGAAGACGGG + Intergenic
1136487341 16:30582084-30582106 CAAAAAAAAGAAAAGAATCCTGG + Exonic
1136636686 16:31528807-31528829 CAGACCATGAAAGAGAAGCCAGG - Intergenic
1137759084 16:50926101-50926123 CAAACCATGAAAAAGAAACGGGG - Intergenic
1137821506 16:51449751-51449773 CAAAACATGGAACTCAAGTCAGG - Intergenic
1137829588 16:51531267-51531289 CAAAAGTTTGAAAAGAAGCTGGG + Intergenic
1137991274 16:53158796-53158818 CAAAAAATACAAAAAAAGCCAGG - Intronic
1138042148 16:53683817-53683839 CAAAAAATGGCAAAGAAGAATGG + Intronic
1138252909 16:55519203-55519225 CAAGAAATGGTAAAGAGGCCGGG + Intronic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1139833768 16:69821851-69821873 CAAAACAAAGAAAAATAGCCGGG - Intronic
1139873308 16:70125079-70125101 GAAAATATGTAAAAGAAGCTGGG + Intronic
1140088719 16:71819343-71819365 CAAAAAATACTAAAGAAGCCAGG + Intergenic
1140212797 16:72983978-72984000 CAAAACAGGGTCAGGAAGCCAGG - Intronic
1140362474 16:74356225-74356247 GAAAATATGTAAAAGAAGCTGGG - Intergenic
1140799008 16:78467908-78467930 AGAAAGGTGGAAAAGAAGCCAGG - Intronic
1141395979 16:83705324-83705346 TAAAAAAAGAAAAAGAAGCCCGG + Intronic
1141534516 16:84669853-84669875 AAAAAAATGGAAAATCAGCCAGG + Intergenic
1141647084 16:85373392-85373414 CAAAAAATGGAAAGAAAGCAAGG + Intergenic
1142045203 16:87920952-87920974 CAAAAAATACAAAAGTAGCCAGG - Intronic
1142317724 16:89358984-89359006 CAAAAAATAGAAAATTAGCCAGG - Intronic
1143557101 17:7668666-7668688 CAAAACATGCAAAAGTTGGCTGG + Exonic
1143749805 17:9020514-9020536 CAAAAACAGGAAGAGAAGCCTGG - Intergenic
1144252724 17:13435939-13435961 CAAAAAATGCAAAATTAGCCAGG - Intergenic
1144316694 17:14069076-14069098 CAAAAAATGTAAAATTAGCCAGG - Intergenic
1144560342 17:16315989-16316011 AAAAACCTGAAAAAGGAGCCGGG - Intronic
1144718597 17:17451775-17451797 CAAAAAATGCAAAATTAGCCAGG + Intergenic
1146147266 17:30430812-30430834 CAAAAAATTAAAAATAAGCCAGG - Intronic
1146186801 17:30729549-30729571 AAAAACAGGGAAAAGATGGCGGG + Intergenic
1147246514 17:39124656-39124678 CAAAACCAGGACAAGAACCCAGG - Intronic
1147274474 17:39303845-39303867 CAAAAAATTAAAAAGTAGCCAGG - Intronic
1147646305 17:42036292-42036314 TAAAATAAGGAAAAGAAGCTAGG - Intronic
1148317301 17:46713324-46713346 CAAAACAGGGAAGGGAAGGCAGG + Intronic
1148804067 17:50255345-50255367 TATAATATGGAAAAGAAGCCTGG - Intergenic
1148834138 17:50456569-50456591 CTAAACATGCAAAATTAGCCGGG + Intronic
1149009625 17:51841850-51841872 CAAAACTTGGAAAGGAAGACAGG - Intronic
1149120877 17:53162353-53162375 GAAAGAATGGAAAAGAGGCCGGG - Intergenic
1149605526 17:57922277-57922299 GGAAACAGGGTAAAGAAGCCTGG - Intronic
1149710279 17:58735490-58735512 CAAAATATAGAAATGAGGCCAGG - Exonic
1150023325 17:61643863-61643885 AAAAAAATGAAAAATAAGCCGGG + Intergenic
1150897052 17:69224118-69224140 CAAAACAGGGTAAAGCAGCCAGG + Intronic
1151173930 17:72271361-72271383 CAAAATATGAAAAATAGGCCAGG + Intergenic
1151234934 17:72713119-72713141 CAAGACATGGCATTGAAGCCCGG + Intronic
1151505612 17:74525155-74525177 CAAGGCATGGAGGAGAAGCCAGG + Intronic
1152418638 17:80179669-80179691 CAAAAATTAAAAAAGAAGCCAGG + Intronic
1152773690 17:82186941-82186963 CAAAAAAAGAAAAAGAGGCCGGG + Intronic
1152845853 17:82599399-82599421 TAAAACATGAACAAGAGGCCAGG - Intronic
1153102933 18:1494976-1494998 AAAAAAAAGGCAAAGAAGCCAGG - Intergenic
1153635961 18:7113779-7113801 TAAAAAATGGGAAAGAGGCCGGG + Intronic
1153794295 18:8609027-8609049 CAAAATAAGAAAAAGAACCCTGG - Intergenic
1153939449 18:9965546-9965568 CAAAAAATGGAAAAGAAGAAAGG - Intergenic
1154217477 18:12425939-12425961 CAAAAAATAAAAAAGAGGCCAGG + Intronic
1154968840 18:21386662-21386684 AAATACATAAAAAAGAAGCCAGG - Intronic
1155061834 18:22235699-22235721 CAAAACATACAAAACTAGCCAGG - Intergenic
1155351711 18:24913766-24913788 CAAAGCACTGAACAGAAGCCTGG - Intergenic
1155384018 18:25257366-25257388 GACAACAAGGAAAACAAGCCTGG + Intronic
1155462413 18:26097825-26097847 CAAAAACTGAAAAAGAGGCCAGG + Intergenic
1156014475 18:32532540-32532562 TAAAGCAAGGAAAAGAATCCAGG - Intergenic
1156123959 18:33880615-33880637 CAACACATGGAAAGGACGCATGG - Intronic
1156533913 18:37844867-37844889 CAAGTCATGGAAACGAAGCAGGG - Intergenic
1156633232 18:38995566-38995588 CAAAAAATGGAAGAAAATCCAGG - Intergenic
1156731120 18:40194289-40194311 CAAAAAATAAATAAGAAGCCAGG - Intergenic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157469486 18:47977902-47977924 TAAAATATGGAAAAGCAGGCCGG - Intergenic
1157997715 18:52578986-52579008 CAAAAAATAGAAAAGAAATCAGG + Intronic
1158279856 18:55812670-55812692 AAAAACATGAAAAAGAAGACAGG + Intergenic
1158973731 18:62691897-62691919 ATAAAAATGGAAAAGAAGCCAGG - Intergenic
1159789102 18:72754476-72754498 AAAAACGTGGAAAAGAAGAATGG + Intronic
1160368843 18:78353645-78353667 CAATACATTCAAAAGAAGGCAGG - Intergenic
1160600364 18:80007988-80008010 CAAAAAATGCAAAATCAGCCAGG + Intronic
1160627969 18:80225984-80226006 CCATACATGTTAAAGAAGCCTGG - Intronic
1160961564 19:1724098-1724120 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1161019101 19:1999503-1999525 AAAAACATTGAAAATTAGCCAGG + Intronic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161861320 19:6800603-6800625 CAAAACAAAAAAAAGAAGCTGGG - Intronic
1162122824 19:8482381-8482403 CAAAAGATGGACCAGAAGCTTGG + Intronic
1162259737 19:9522722-9522744 CCAAAGATTGAAAAGAGGCCAGG + Intergenic
1162827816 19:13264383-13264405 TAAAACATGGAAGAAAAGGCAGG - Intronic
1163432201 19:17275064-17275086 CAAAACATTCAAAATTAGCCAGG - Intronic
1163623568 19:18374887-18374909 CAAGAAATTGAAAAGAGGCCTGG + Intronic
1163658322 19:18561254-18561276 AAAAACAAGGTAAAGTAGCCTGG + Intronic
1163734397 19:18970227-18970249 AAAAACTTTGAAAAGTAGCCGGG + Intergenic
1163955962 19:20640849-20640871 CAAAATACGTAAAAAAAGCCAGG + Intronic
1165229035 19:34374887-34374909 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1165410518 19:35657950-35657972 CAAAAAATAAAAAATAAGCCGGG - Intronic
1165491705 19:36127330-36127352 CAAAAAAAAGAAAAAAAGCCAGG + Intergenic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1165954994 19:39496968-39496990 AAATACAGGGAAAAGGAGCCTGG + Intergenic
1166001847 19:39882226-39882248 CAAAAAATTGAAAATTAGCCAGG - Intronic
1166004630 19:39898477-39898499 CAAAAAATTGAAAATTAGCCAGG - Intronic
1166586536 19:43953919-43953941 CAAAAAATAGAAAATTAGCCAGG + Intronic
1166740002 19:45108800-45108822 CAAAACATACAAAATTAGCCGGG - Intronic
1167231665 19:48288702-48288724 TAAAAGATTGAAAAGAGGCCGGG - Intergenic
1167447125 19:49544106-49544128 AAAAAAAGGGAAAAAAAGCCTGG + Intronic
1168184265 19:54688139-54688161 CTGAACATGGAAAAGAAACATGG + Intronic
1168419318 19:56190875-56190897 GAAAACAGGGAAGAGAACCCAGG - Exonic
1168423772 19:56222629-56222651 GAAAACAGGGAAGAGAACCCAGG - Exonic
1168432878 19:56295296-56295318 AAATACATGGAAAAAAGGCCTGG + Intronic
925172942 2:1761916-1761938 CTAAACATGGAAAGGAACACTGG + Intergenic
925387651 2:3473278-3473300 AAAAACATGGAAGAGAAGCTAGG + Intronic
925426447 2:3752397-3752419 CAATACTTGGAAAACAAACCAGG - Intronic
925791862 2:7497376-7497398 CATAGCATAGCAAAGAAGCCCGG + Intergenic
926052707 2:9755012-9755034 CAGAACATGGAAACGGAGCAAGG + Intergenic
926156214 2:10455397-10455419 CAAAAACAGGAAAAGAATCCAGG - Intergenic
926509626 2:13758590-13758612 AAAAAGATGCAAAAGAAGACAGG + Intergenic
926985219 2:18615243-18615265 CAAAACATGAAAAATATGTCAGG + Intergenic
927563916 2:24094231-24094253 CAAAACTTTAAAAAGTAGCCAGG - Intronic
927612890 2:24559641-24559663 CAAAACATGGAAGAAAGGGCAGG - Intronic
928075166 2:28257879-28257901 AAAAAGAAAGAAAAGAAGCCGGG + Intronic
928077074 2:28274639-28274661 TAAAACATGGTTTAGAAGCCTGG - Intronic
929320809 2:40541617-40541639 CGAAAAATGCAAAAGTAGCCAGG - Intronic
929558107 2:42937945-42937967 AGAAACATGGGAAAGAAGTCAGG - Intergenic
929696241 2:44118261-44118283 AAAAAAATGGAAAATAGGCCGGG - Intergenic
929800941 2:45101779-45101801 CAAAAAATATAAAATAAGCCGGG - Intergenic
930446316 2:51477490-51477512 CAGAACATGGAAAATAATCAAGG - Intergenic
930479759 2:51932229-51932251 TAAAAAAAAGAAAAGAAGCCCGG - Intergenic
930954226 2:57185319-57185341 CAAAATCTGGAAAAGAAACAAGG + Intergenic
931746921 2:65298946-65298968 CAAAAAAAGAAAAAGAAGCTGGG - Intergenic
931859667 2:66341649-66341671 CAAAAGATGGAAATGAACCTTGG - Intergenic
932151920 2:69380936-69380958 CCAAAAATGAAAAAGAAGCTGGG - Intronic
932746264 2:74336228-74336250 CAAAAAATTAAAAAGTAGCCTGG - Intronic
932777686 2:74538031-74538053 CAAAACAGACAAAGGAAGCCTGG + Intronic
933501474 2:83117482-83117504 AAACACTTGAAAAAGAAGCCAGG - Intergenic
933573126 2:84036707-84036729 CAAATCATGGCAAAGAAGAAGGG + Intergenic
934684098 2:96307785-96307807 CAAAAAATTAAAAAGTAGCCAGG + Intergenic
934752884 2:96805403-96805425 AAAAAAACTGAAAAGAAGCCAGG - Intronic
934849649 2:97689831-97689853 TTAAAAATGGAAAACAAGCCAGG + Intergenic
935165934 2:100568634-100568656 CAAAAAAAGGAAAATAAGCGGGG + Intronic
935273113 2:101451930-101451952 AAAAACATGAAAAACTAGCCAGG + Intronic
935644652 2:105324365-105324387 CAAGAAATAGAAAAGAAACCTGG + Intronic
935973765 2:108557236-108557258 CAAAAAATGAAAAATTAGCCAGG - Intronic
936276603 2:111103132-111103154 GAAAACATGAAAAATTAGCCAGG + Intronic
936459955 2:112706284-112706306 CAACACGTGCAAAGGAAGCCAGG - Intergenic
937230198 2:120393995-120394017 TAAAAAATGGAAAAGAAGGAGGG - Intergenic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937638139 2:124179963-124179985 AAAAAAATGGAAAAGAATCATGG - Intronic
937707566 2:124938583-124938605 CAAAAGGAGGAAAAGAAGCAAGG - Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
938059475 2:128240813-128240835 TAAAAAGTGGAAAAGCAGCCGGG - Intronic
938141489 2:128798319-128798341 CAGAAGCTGGAAAAGAACCCAGG - Intergenic
938369360 2:130759500-130759522 CAAAACATAGAAAAGAATAAGGG + Intronic
938609046 2:132927600-132927622 CAAAACAAACAAAAGAACCCTGG - Intronic
939369872 2:141285380-141285402 TAAAAGAAGGAAAAGAGGCCAGG - Intronic
939442310 2:142264751-142264773 CAAAACAAAAAAAAGAGGCCTGG - Intergenic
939958635 2:148547217-148547239 CACAAGATGGAAAAGAACCCAGG - Intergenic
940259137 2:151762240-151762262 TAAAAGATGGAAAAGAAACCAGG - Intergenic
941102758 2:161314652-161314674 CACACTATGTAAAAGAAGCCAGG - Intronic
941982120 2:171470182-171470204 CAAAAAATAAAAAAGTAGCCAGG - Intronic
942296032 2:174518002-174518024 CAAAACTTTGAAAATAAGCATGG - Intergenic
942985914 2:182141994-182142016 CAAAACATGACAAGGAAGCAGGG + Exonic
943852180 2:192738101-192738123 CAAAGCATGGAAAAAAAGCTTGG - Intergenic
944455132 2:199885370-199885392 CAAAAAATACAAAAGTAGCCAGG + Intergenic
944588410 2:201193767-201193789 AATAACATGAAAAAGAAGGCAGG + Intronic
945661387 2:212689233-212689255 CAAAATATGAAAAATTAGCCAGG + Intergenic
945887028 2:215386487-215386509 TAGAATATGGTAAAGAAGCCCGG - Intronic
946043102 2:216799318-216799340 CAAATAATGGTAAATAAGCCAGG + Intergenic
946111628 2:217424576-217424598 CAAAACATGAAAAAGAAAGAAGG + Intronic
946228935 2:218279814-218279836 CAAAACATGGTCAAGAAGAGAGG + Intronic
947277377 2:228407813-228407835 CAAAACATGTAAATTAAGCTTGG + Intergenic
947372254 2:229459860-229459882 CAAAACAAAAAAAAGAGGCCGGG + Intronic
947468847 2:230381663-230381685 CAAAACAACCAAAACAAGCCTGG + Intronic
948006524 2:234613796-234613818 CAAAAAGTGGAGAAGAAGGCTGG + Intergenic
948437488 2:237963673-237963695 CAAAATATGTCAAAGAAGGCTGG - Intergenic
948708739 2:239812122-239812144 CAAAACATGGAAAATAACAAGGG - Intergenic
948966191 2:241382442-241382464 CAAAAAATGCAAAATTAGCCGGG - Intronic
949080199 2:242089979-242090001 TAAAACAAGGAAAACAAGACAGG - Intergenic
1169160018 20:3369535-3369557 CTAAAAATAGAAAAGTAGCCGGG - Intronic
1169185544 20:3614000-3614022 CTAATTATGGAAAAGAATCCTGG - Intronic
1169349344 20:4855652-4855674 CAAGACTTGCAACAGAAGCCCGG + Exonic
1170378411 20:15728844-15728866 AAAAACATAGAAAAGAATCCAGG - Intronic
1170661430 20:18344173-18344195 CAAAAGATGGCAAACAGGCCAGG - Intergenic
1170961294 20:21028098-21028120 AAAAACATACAAAATAAGCCAGG + Intergenic
1171119019 20:22552196-22552218 TAAAAAATGGACAAGAAGCCTGG + Intergenic
1172219643 20:33264681-33264703 CAAAATATGAAAAATGAGCCAGG + Intergenic
1172263228 20:33587425-33587447 AAAAACATGAAAAATTAGCCGGG - Intronic
1172406511 20:34693805-34693827 CAAAAAAAGAAAAAAAAGCCGGG - Intergenic
1172708153 20:36898616-36898638 CAAGAAATGGAACAGAGGCCGGG + Intronic
1172726776 20:37049899-37049921 CAAAAAATACAAAAGTAGCCAGG + Intronic
1172736666 20:37131218-37131240 CAAAAAATGCAAAATTAGCCAGG + Intronic
1172754287 20:37272547-37272569 CAAAAAATACAAAAGTAGCCTGG - Intergenic
1172938149 20:38635500-38635522 CAAAAAATAAAAAAGTAGCCAGG + Intronic
1173056787 20:39622357-39622379 CAAAACAAACAAAAGAGGCCAGG + Intergenic
1173282632 20:41643115-41643137 CAAAACATGGTCAAGGGGCCGGG - Intergenic
1173839299 20:46146783-46146805 CAAAAAATGAAAAATTAGCCAGG - Intergenic
1174015104 20:47481468-47481490 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1174099780 20:48118444-48118466 CAACTCATGGCAAGGAAGCCTGG + Intergenic
1174367249 20:50063995-50064017 CAAAAAATGCAAAATTAGCCAGG + Intergenic
1174510274 20:51046067-51046089 CTGAACATGGAACAGAAGCCAGG - Intergenic
1174684980 20:52446034-52446056 CAAATGAGGGAAAAGAAGGCAGG + Intergenic
1174829777 20:53801976-53801998 CAAAAGGTGGAAAATAGGCCGGG - Intergenic
1174842024 20:53910096-53910118 CAAAACATCAAAAATTAGCCAGG - Intergenic
1175289001 20:57860761-57860783 GAAAAGATGCAAGAGAAGCCGGG - Intergenic
1175411661 20:58774120-58774142 AAAAATATGGAAAACAGGCCTGG - Intergenic
1175536169 20:59715472-59715494 CAAAACATGGAAAACAAGTTAGG - Intronic
1176264980 20:64204438-64204460 CCACGCAGGGAAAAGAAGCCGGG - Intronic
1177228594 21:18289349-18289371 CTAAAAATGCAAAAGTAGCCGGG + Intronic
1177789606 21:25708405-25708427 CAAAAAATAAAAAATAAGCCAGG + Intronic
1177812497 21:25939232-25939254 CAGAACATGGGAAGGAAGCCAGG + Intronic
1177916180 21:27090551-27090573 CAAAAAAATGCAAAGAAGCCTGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178506801 21:33169289-33169311 CAAAACATAAAAAATTAGCCAGG + Intronic
1178990615 21:37352542-37352564 CAAAAAATGCAAAAAAGGCCAGG + Intergenic
1179094847 21:38304469-38304491 CAAAACTTGGAAATCAAGACTGG - Exonic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179291283 21:40020356-40020378 CAAAACAAGGAAAAGAAGGAAGG - Intronic
1179723808 21:43330771-43330793 CCAAACATGGACACGATGCCTGG - Intergenic
1179823189 21:43949077-43949099 CTAAACAGGGAAGAAAAGCCAGG - Intronic
1180795826 22:18604679-18604701 AAAAAAGTGGAAAAGAAGGCCGG + Intergenic
1181225900 22:21390592-21390614 AAAAAAACGGAAAAGAAGGCCGG - Intergenic
1181252733 22:21544221-21544243 AAAAAAACGGAAAAGAAGGCCGG + Intergenic
1181613683 22:24036962-24036984 AAAAACATGGAAACCAGGCCGGG + Intronic
1181677367 22:24464449-24464471 AAAAACATAAAAAATAAGCCGGG - Intergenic
1181692708 22:24573721-24573743 CAAAAAATTGAAAAGTAGCTGGG + Intronic
1181759361 22:25047453-25047475 AAAAAAAAGGAAAAGAGGCCAGG - Intronic
1182020757 22:27079860-27079882 CAAAAAATTAAAAAGAGGCCAGG - Intergenic
1182218655 22:28740858-28740880 CAAAAAATTGAAAATAGGCCGGG + Intronic
1182662487 22:31934809-31934831 CAAAAAATAGAAAATTAGCCAGG + Intronic
1182863434 22:33581488-33581510 TGAAGCATGGAAAACAAGCCAGG - Intronic
1183396138 22:37571894-37571916 AAGAACATGGACATGAAGCCGGG - Exonic
1183447591 22:37868801-37868823 CAAAAAATGCAAAACTAGCCAGG - Intronic
1183835705 22:40451163-40451185 CAAAAAATGGAAGTCAAGCCCGG - Intronic
1183964011 22:41430506-41430528 CATAAAAGAGAAAAGAAGCCAGG - Intergenic
1183965640 22:41440410-41440432 CAAAAAAAGAAAAAGAGGCCAGG - Intronic
1184548653 22:45191506-45191528 GAAAAAATGGAATAGAGGCCAGG - Intronic
1184823593 22:46931830-46931852 CATAACATGCAACAGCAGCCAGG - Intronic
1184996874 22:48213730-48213752 CAAAAGAGGGCAAAGAAGACAGG + Intergenic
1185251953 22:49807020-49807042 CACACCAGGGAAAAGAACCCCGG + Intronic
1185304731 22:50108318-50108340 CAACACATGCAGGAGAAGCCTGG - Intronic
1203240910 22_KI270733v1_random:18286-18308 AAAAATATGGAAGATAAGCCAGG + Intergenic
949245070 3:1917620-1917642 CTAAACATGGAAAGGAAAACTGG - Intergenic
949484745 3:4527335-4527357 CAAAAATTTAAAAAGAAGCCAGG - Intronic
949645258 3:6086007-6086029 CAGAAATTGGAAAAGAAGCTGGG - Intergenic
949650833 3:6157141-6157163 CAAAGCATAGAGAAGCAGCCTGG + Intergenic
950036047 3:9886478-9886500 CAAAAAATGTAAAATAAGCCAGG + Intergenic
950082065 3:10229803-10229825 AAAAAAATGAAAAAGAGGCCGGG + Intronic
951186140 3:19715686-19715708 CAAAAAATGAAAAATTAGCCAGG - Intergenic
951300705 3:20992746-20992768 TAAAACAAGGTAAAGAAGTCAGG - Intergenic
951473525 3:23081041-23081063 CAAAAAATGAAAAATTAGCCAGG + Intergenic
951641320 3:24839405-24839427 AAAAAAATGGGAAGGAAGCCAGG + Intergenic
951942593 3:28096043-28096065 CAAAAAATAGAAAAGAAATCAGG - Intergenic
953152626 3:40338921-40338943 CTAAAAAGGGAGAAGAAGCCAGG + Intergenic
953992384 3:47494377-47494399 CAAAACAAAGAAAAGAGGCTGGG + Intergenic
954032027 3:47826324-47826346 AAAAACAAGAAAAAGAAGCGAGG + Intronic
954180392 3:48877096-48877118 AAAAAAATAGAAAAGAGGCCAGG + Intronic
954273525 3:49527540-49527562 CAAAACACGAAAAATTAGCCAGG + Intronic
954532856 3:51335829-51335851 GAAAAATTGGAAAAGTAGCCAGG + Intronic
955356438 3:58236783-58236805 GAAAACACGGAAGAGTAGCCAGG + Intergenic
955634803 3:61015829-61015851 AAAAGCAAGGAAAAAAAGCCAGG + Intronic
957487366 3:80880192-80880214 AAAAACATGGAAAATTGGCCTGG - Intergenic
957569851 3:81932518-81932540 CAAAAGAGGAAAATGAAGCCAGG - Intergenic
958038308 3:88195619-88195641 CAAAAAATGCAAAATTAGCCAGG - Intergenic
958711445 3:97721797-97721819 GAAAAACTGGAAAAGCAGCCAGG - Intronic
959778178 3:110195370-110195392 CAAAAGAAGAAAAAGAAGCTAGG + Intergenic
959886412 3:111507013-111507035 AAAATTATGTAAAAGAAGCCCGG + Intronic
960031457 3:113058774-113058796 CAAAACATGGATTTGCAGCCAGG + Intergenic
960117839 3:113914662-113914684 AAAACCAAGGAACAGAAGCCTGG - Intronic
960128468 3:114026691-114026713 CTATATATGGAAAAGAAGCCTGG - Intronic
961151992 3:124646684-124646706 AAAAAAATGGAAAAGAGGCCGGG - Intronic
961753597 3:129112958-129112980 AAAAACAGTCAAAAGAAGCCTGG - Intronic
961992877 3:131211111-131211133 CTAAACATGGAAAGGAAAACTGG - Intronic
962749224 3:138421070-138421092 CAAAATATGTGAAAGAATCCGGG + Intergenic
963240297 3:142996360-142996382 CAAAACTTGAAAAAGAAGAAAGG + Intronic
963290207 3:143479546-143479568 CAAAACATGTAACTCAAGCCTGG - Intronic
963425735 3:145120344-145120366 CAAAATGTGTAAAAGAAGCAGGG - Intergenic
963531705 3:146479097-146479119 CTAAACATGGAAAGGAAAACCGG + Intronic
964034997 3:152184778-152184800 AAAAGCATGGAAAAGAGGCAGGG - Intergenic
964215972 3:154283000-154283022 CAAAACAAGGAAAAGAAACATGG - Intronic
964233662 3:154499374-154499396 GAAAAAATGGCAAAGAAGCAAGG + Intergenic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965340086 3:167479932-167479954 TAAAGCATGGAAAAAAAGGCCGG + Intronic
965762343 3:172092977-172092999 CAAAAAATAAAAAAGTAGCCAGG - Intronic
966493935 3:180558322-180558344 CTAAACATGGAAAGGAAAACTGG + Intergenic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
966716049 3:183013782-183013804 TAAAAGAGGGAAAAGCAGCCGGG - Intergenic
967107876 3:186268757-186268779 AAAAACGTTGAAAAGAAGCAGGG + Intronic
967345961 3:188456051-188456073 CAAAAAATAGAAAATTAGCCAGG - Intronic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
969122141 4:4918579-4918601 TCAAAGATGGAAAAGGAGCCTGG + Intergenic
969437601 4:7197690-7197712 CAAACCATAGAAAAGAAGTTTGG + Intronic
969670604 4:8588027-8588049 CAAACCATGGAAAGGAAGGCAGG - Intronic
969727362 4:8928735-8928757 CAAAAAATAGAAAATTAGCCAGG - Intergenic
969759490 4:9171781-9171803 AAAAAGATGGAAAAGAAGACAGG + Intronic
970385303 4:15550026-15550048 TAAAACACAGGAAAGAAGCCAGG + Intronic
970680532 4:18502261-18502283 CAAAGCCAGGAAAACAAGCCTGG - Intergenic
970854509 4:20636681-20636703 AAAAATATAGAAAAGTAGCCGGG + Intergenic
971055562 4:22909194-22909216 CAAAAAATGCAAAATTAGCCAGG - Intergenic
971065669 4:23029646-23029668 CAATCTATGGAAAAGAAGCTGGG - Intergenic
971183576 4:24352601-24352623 CAAAAGCTGGAAAGGAAGCTGGG + Intergenic
972145129 4:36014444-36014466 CAAAACAAGGAAAAGAAATTGGG + Intronic
972153679 4:36129320-36129342 AGGAACAGGGAAAAGAAGCCTGG - Intronic
972611165 4:40656854-40656876 GAAAACATTGAAAATTAGCCGGG + Intergenic
973274667 4:48294054-48294076 CAAAACCAGGTAAAAAAGCCAGG + Intergenic
973932667 4:55808724-55808746 CAAAGCAAGGAAAAGAAGGATGG + Intergenic
974921161 4:68240773-68240795 GAAACAAAGGAAAAGAAGCCAGG + Intronic
974932499 4:68375077-68375099 AAAAACATGAAAAATTAGCCAGG - Intergenic
975245161 4:72111994-72112016 CAAATCCTGGTAAAAAAGCCAGG - Intronic
975653583 4:76619142-76619164 AAAGAAATGAAAAAGAAGCCTGG - Intronic
976184805 4:82432628-82432650 CAAAACGTGGGGAAGAGGCCGGG - Intronic
976253630 4:83078420-83078442 CAAAAAATATAAAAGTAGCCAGG + Intergenic
976892922 4:90072564-90072586 CAAAACATGCAAGACAAGTCAGG - Intergenic
977305224 4:95316202-95316224 GAAAACATGTAAAAGGAGCCTGG + Intronic
977564637 4:98568558-98568580 CAAAAAAAAGAAAAGAAGTCTGG + Intronic
977580451 4:98718981-98719003 CTGAACATGGAAAGGAAACCAGG + Intergenic
978770721 4:112453706-112453728 AAAATCATGGAAAAGAAGATGGG - Intergenic
980469271 4:133230320-133230342 CAAAACAAGAAATAGAAGCCAGG + Intergenic
980508129 4:133749550-133749572 CAAAATAGGGAGAAGAAGCTTGG - Intergenic
980610755 4:135159613-135159635 CAAAATACAGAAAAGATGCCAGG + Intergenic
980813701 4:137916115-137916137 CTAAACATGGAAAGGAACACTGG + Intergenic
980996939 4:139788240-139788262 CACAGGTTGGAAAAGAAGCCAGG - Intronic
980998668 4:139807114-139807136 CAGAAACTGGAATAGAAGCCAGG - Intronic
981228530 4:142325141-142325163 CAACACCTAGAAAAGAAGCTAGG - Intronic
981924543 4:150123877-150123899 CAAAAAATTAAAAAGTAGCCGGG + Intronic
981941065 4:150281946-150281968 AAAAACATGTTAAAGAAGCTGGG - Intronic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
982609390 4:157554268-157554290 CAAAACTAGGATAAGAAGCAAGG - Intergenic
982777311 4:159455084-159455106 CAAAACAAGCAAAACAGGCCGGG + Intergenic
983033047 4:162827570-162827592 CAAAAAATAGAAAAGAGGCCGGG + Intergenic
983538753 4:168886478-168886500 CAAAAAATGGAAATTTAGCCAGG + Intronic
983624896 4:169792314-169792336 CAAAAGAAAAAAAAGAAGCCAGG + Intergenic
984520846 4:180799052-180799074 AAAAACATGGCAAAAAGGCCAGG - Intergenic
984875785 4:184366225-184366247 CAAAACATGGGAGAGAACCAAGG + Intergenic
985049687 4:185976748-185976770 AAAAGAATGGAAAAGAGGCCAGG + Intergenic
985909932 5:2871344-2871366 CATAATATGCAAAAGAAACCTGG - Intergenic
985928019 5:3033121-3033143 CACAACATGGAACTGAAGCCTGG - Intergenic
985945494 5:3179235-3179257 CAAAACACAGAAAATAAGTCAGG + Intergenic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
986191326 5:5498656-5498678 AAAAATATGAAAAAGTAGCCAGG + Intergenic
986467489 5:8040685-8040707 CAAAACATGGGAAAAAAGTGGGG - Intergenic
986751191 5:10789394-10789416 GAAAACATTGAAAAGAGTCCAGG + Intergenic
986833941 5:11613263-11613285 AAAATTATGGAGAAGAAGCCAGG - Intronic
987696241 5:21337013-21337035 TAACAAATGGAAAAGAAGACAGG + Intergenic
988820816 5:34883065-34883087 CAAAACAGAGAAAAGAAGAGAGG + Intronic
988990410 5:36664849-36664871 CAAAACAGGGAAAATAATACAGG + Intronic
989133268 5:38128130-38128152 AAATACATGGAACAGAAACCAGG - Intergenic
989410865 5:41118990-41119012 CAAAACAAGGACTAGAGGCCGGG - Intergenic
990448676 5:55916217-55916239 CAAAAAATTAAAAAGTAGCCAGG + Intronic
991366154 5:65870210-65870232 CTAAACATGCAAAATTAGCCGGG + Intronic
991744159 5:69715074-69715096 TAACAAATGGAAAAGAAGACAGG - Intergenic
991753547 5:69840163-69840185 TAACAAATGGAAAAGAAGACAGG + Intergenic
991795731 5:70294798-70294820 TAACAAATGGAAAAGAAGACAGG - Intergenic
991803164 5:70396890-70396912 TAACAAATGGAAAAGAAGACAGG + Intergenic
991823533 5:70590341-70590363 TAACAAATGGAAAAGAAGACAGG - Intergenic
991832866 5:70715287-70715309 TAACAAATGGAAAAGAAGACAGG + Intergenic
991888101 5:71294316-71294338 TAACAAATGGAAAAGAAGACAGG - Intergenic
992059259 5:73025672-73025694 AAAAACATACAAAAGAGGCCAGG - Intronic
992108155 5:73467626-73467648 CAAAATATACAAAAGTAGCCTGG - Intergenic
993867220 5:93209835-93209857 CACAAAAAGGAAAAGATGCCAGG + Intergenic
994079655 5:95693997-95694019 CAAAACATAAAAAAGTAGCCTGG + Intronic
994519482 5:100813292-100813314 CAAAACAGGGAAAATATACCTGG + Intronic
995182195 5:109239549-109239571 AAAAACAGGATAAAGAAGCCAGG + Intergenic
995201049 5:109425543-109425565 CAGAAAATAGAAAAGAACCCTGG - Intergenic
995701773 5:114943611-114943633 AAAAACATGAAAAATTAGCCAGG + Intergenic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
996837707 5:127812237-127812259 CAAAACATGGAAATGTATGCTGG - Intergenic
997109790 5:131062430-131062452 CAAAACACAGAAAAGATGCCAGG + Intergenic
997193606 5:131962785-131962807 CAACAGATGGAAAAGAAATCGGG - Intronic
997224643 5:132199903-132199925 AAAAACGTGGGACAGAAGCCAGG + Intronic
997724227 5:136106754-136106776 AAAAAAAAGGAAAAGAAACCAGG + Intergenic
997753987 5:136377416-136377438 CAAAAAATGTAAAAAGAGCCAGG - Intronic
997938586 5:138136087-138136109 CAAAAGATTGAAAATAACCCAGG - Intronic
997949924 5:138234298-138234320 CAAAACATGAAAAATTAGCTGGG - Intergenic
997976327 5:138443700-138443722 CAAAAAATAAAAAATAAGCCAGG - Intronic
998238950 5:140425552-140425574 CAAAAAACAGAAAAGAGGCCTGG - Intronic
998970924 5:147591657-147591679 GAAAACATGGATAAGATCCCAGG - Exonic
999797196 5:155000062-155000084 CAAAACAAGAAAAAGAAACTGGG - Intergenic
999799795 5:155022835-155022857 CAAATCATGCAAAAGATGCTGGG - Intergenic
999930180 5:156423736-156423758 CAAAGCATGGAGAAGAACCCAGG - Intronic
999955863 5:156700780-156700802 CAAAAAATAGAAAATTAGCCAGG + Intronic
1000251047 5:159496030-159496052 CAAAACATGGAAGGTAAACCAGG - Intergenic
1000328988 5:160192948-160192970 CAAAAAATAAAAAATAAGCCAGG + Intronic
1001060622 5:168485624-168485646 AAAAAAATGGAAAAATAGCCGGG - Intergenic
1001077394 5:168640530-168640552 AAAGACATGTACAAGAAGCCAGG - Intergenic
1001256146 5:170184846-170184868 GAAAATATGGAAGAGAAGCATGG - Intergenic
1001525076 5:172423146-172423168 CAATACATTGATAACAAGCCCGG + Intronic
1001917934 5:175577018-175577040 CAAAACATACAAAATTAGCCAGG + Intergenic
1002127093 5:177054230-177054252 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1002135182 5:177103203-177103225 CAAAAAATAAAAAAGTAGCCGGG + Intergenic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002548549 5:179969692-179969714 CAAAACATAAAAAAGTGGCCAGG + Intronic
1003498476 6:6685005-6685027 CAAGGCATAGAAAAGATGCCTGG + Intergenic
1003744341 6:8982834-8982856 CAAAACTTGGCAAAGAAACCCGG - Intergenic
1003927710 6:10892458-10892480 CAAAAAATGAAAAACTAGCCAGG - Intronic
1004345179 6:14842890-14842912 CAAAAAATGCAAAAAAGGCCAGG + Intergenic
1004526743 6:16415915-16415937 CAAAACAGGAAAAAGAAGGAGGG + Intronic
1004920822 6:20373852-20373874 TCCAACATGGAAACGAAGCCAGG + Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005155295 6:22798319-22798341 CAAAACATGCAATAGCAGCATGG + Intergenic
1005217793 6:23552190-23552212 CAAAACATGAAACAAAACCCTGG + Intergenic
1005226930 6:23654033-23654055 CAAAAGCTAGAAAAGAAGCCTGG + Intergenic
1005411125 6:25548030-25548052 CAAAGCATGGAAACAGAGCCTGG + Intronic
1005554547 6:26961015-26961037 TAACAAATGGAAAAGAAGACAGG - Intergenic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005907027 6:30271153-30271175 CAAAACTTGGAGAAGAAAGCAGG + Intergenic
1006057020 6:31392735-31392757 AAAAACATGCAAAAGAAGAGTGG - Intergenic
1006063803 6:31446063-31446085 CAAAACATGGGATAGAGGCTGGG - Intergenic
1006149380 6:31978285-31978307 CAAAAAATGTAAAAACAGCCAGG - Intronic
1006164307 6:32055745-32055767 GGAAACGTGCAAAAGAAGCCCGG + Intronic
1006311796 6:33266299-33266321 CAAAAAATGAAAAATTAGCCGGG - Intronic
1006476627 6:34259557-34259579 CAAAAAATTAAAAATAAGCCAGG + Intergenic
1006540300 6:34734601-34734623 CAAAAAATGAAAAATAAGGCTGG - Intergenic
1007454213 6:41963670-41963692 CAAAACATGGTAAAGAAGCATGG + Intronic
1007488429 6:42198824-42198846 CTAAAAATAGAAAATAAGCCAGG - Intergenic
1007639132 6:43322848-43322870 TAAAATATAAAAAAGAAGCCAGG + Intronic
1008603525 6:53118436-53118458 CAAAAAATCAAAAAGTAGCCTGG - Intergenic
1008694541 6:54019180-54019202 CAAAACATGGAAACAGAGGCCGG - Intronic
1008750800 6:54731726-54731748 CAAAAAAAACAAAAGAAGCCAGG + Intergenic
1010984483 6:82407971-82407993 AAGAACATGGACAAGAAGCAAGG - Intergenic
1011010254 6:82695489-82695511 CAGCACATGGAAATGAAGCATGG - Intergenic
1011130961 6:84051560-84051582 TAAAAGAAGGAAAAGAGGCCAGG + Intronic
1011861085 6:91757527-91757549 GAAAAGATGGAAACGAATCCTGG + Intergenic
1012177032 6:96100558-96100580 CAAAATATGGACAAGAACTCTGG + Intronic
1012551834 6:100470149-100470171 CAAAAAAGGGAGAGGAAGCCGGG + Intergenic
1012599932 6:101082994-101083016 CAAAAAAAGGAATAGAAGCTTGG + Intergenic
1012743119 6:103045929-103045951 CTAAAAATGAAAAAGTAGCCAGG + Intergenic
1012787558 6:103651198-103651220 CAAAACATGGAAAAAAAGGAAGG - Intergenic
1013507610 6:110815396-110815418 CAAAACAAGGAAATGAAGGAGGG - Intronic
1014195330 6:118551221-118551243 AAACACATGAAAATGAAGCCTGG + Intronic
1014398525 6:120957222-120957244 CAAAAAGTGGAAAAGAAACAAGG - Intergenic
1014762221 6:125369055-125369077 CTAAATATGGAAAATAACCCAGG + Intergenic
1014838319 6:126185396-126185418 CAGGACATGCAAAAGAAGCCTGG - Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015561326 6:134519217-134519239 AAAAACATAGAAAATTAGCCGGG + Intergenic
1015784834 6:136911701-136911723 CAAAAAATCGAAAACAAGGCTGG - Intronic
1016046351 6:139484413-139484435 CAAATCATGAAAAAGAAATCTGG - Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017468356 6:154716081-154716103 CACAAAATGCAAAAAAAGCCAGG - Intergenic
1017822373 6:158059094-158059116 CAAATCGTGGAAAATGAGCCTGG - Intronic
1018538340 6:164848474-164848496 CAAAAGATGCAAAAGCACCCAGG - Intergenic
1018865841 6:167746491-167746513 TAAACCATGGAAATGGAGCCAGG + Intergenic
1019013161 6:168859331-168859353 CAAAACATGTAAAAGAGCCCTGG + Intergenic
1019116895 6:169772240-169772262 CACATCTTGGAACAGAAGCCAGG + Intronic
1019291218 7:251355-251377 CAAAAAATGAAAAATTAGCCAGG + Intronic
1019298787 7:292690-292712 CAGAACATGCAAAAGATGCTTGG + Intergenic
1019822291 7:3253980-3254002 CAAAAAATGAAAAATTAGCCAGG + Intergenic
1019824745 7:3274822-3274844 CTAAAAATGGAAAATTAGCCAGG + Intergenic
1019825715 7:3282651-3282673 CAAACCCTGGAAATGCAGCCAGG + Intergenic
1020046948 7:5047236-5047258 CAAAAAATACAAAAGTAGCCAGG + Intronic
1020292305 7:6731115-6731137 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1020359143 7:7308489-7308511 TAAAACATTGAAAGGAAGCAAGG - Intergenic
1020588468 7:10103614-10103636 CAAAACATAAAAAATTAGCCAGG + Intergenic
1020942195 7:14554166-14554188 TAAAACATGTAAAGGAAGGCCGG - Intronic
1021556608 7:21925726-21925748 CAAAACATAAAAAATTAGCCAGG + Intronic
1021751278 7:23802807-23802829 ATATACATGGAAAAGCAGCCAGG - Intronic
1021967246 7:25932765-25932787 GAAAACATTGAACAGAAGCTGGG + Intergenic
1022062525 7:26812169-26812191 CAAAAGAGGGAAAAGAAGTGAGG - Intronic
1022087668 7:27084734-27084756 CAAAAAAGAAAAAAGAAGCCGGG + Intergenic
1022254094 7:28638505-28638527 CAAAAAATCCAAAATAAGCCAGG - Intronic
1022445709 7:30469161-30469183 CTTAACCTGGAAAACAAGCCCGG + Intronic
1022472438 7:30690017-30690039 CAAAAGATAGAAAAGCACCCAGG + Intronic
1023113440 7:36837679-36837701 CAAATTCTGGAAAAGAAGCTAGG - Intergenic
1023142554 7:37116797-37116819 AAAACCATGGAAAGGCAGCCTGG + Intronic
1023275455 7:38514660-38514682 CACAAAACGGAAAAGAAGTCAGG - Intronic
1023409624 7:39876672-39876694 TAAAACTTGCCAAAGAAGCCGGG - Intergenic
1024436088 7:49356366-49356388 CAAAGCATGGAATTGAAACCTGG - Intergenic
1024573992 7:50748868-50748890 CAAAACAGGGAAAAGCTACCAGG + Intronic
1024748482 7:52434246-52434268 CAAAACAAGCAAACAAAGCCTGG - Intergenic
1025043242 7:55666883-55666905 TAAAACTTGCCAAAGAAGCCGGG + Intergenic
1025098744 7:56117504-56117526 CAAAACACACAAAAAAAGCCAGG + Intergenic
1025136162 7:56415406-56415428 TAAAACTTGCCAAAGAAGCCGGG + Intergenic
1025248153 7:57333226-57333248 CAAAAAATACAAAAAAAGCCGGG - Intergenic
1025834604 7:65082553-65082575 CAAAACAAACAAAAAAAGCCAGG + Intergenic
1025918454 7:65887008-65887030 AAAAACATGTAAAATCAGCCAGG - Intronic
1026113000 7:67473324-67473346 CAAAACATTTAAAATTAGCCAGG - Intergenic
1026251793 7:68677632-68677654 AAAAATATGGAAAATTAGCCGGG + Intergenic
1026287166 7:68973464-68973486 AAAAACAAGAAAAAGGAGCCAGG - Intergenic
1026479981 7:70769795-70769817 CCAAAGATGGAGAATAAGCCTGG + Intronic
1027121646 7:75526702-75526724 CAAAAAATACAAAAGCAGCCAGG - Intergenic
1027406094 7:77862673-77862695 CAAAAAATGAAAAAGATTCCAGG - Intronic
1027506849 7:79026576-79026598 TAAAAAATGGGCAAGAAGCCAGG + Intronic
1027649396 7:80846624-80846646 AAAAACATGGAAAAGGGGCTGGG - Intronic
1028444692 7:90908105-90908127 GAAAACATTCAAAAAAAGCCTGG - Intronic
1028600126 7:92591873-92591895 TAAAACATGAAAAATAAGCCAGG - Intergenic
1028888468 7:95960522-95960544 GAAAACAAGAAAAAGAAGGCTGG - Intronic
1029120105 7:98262010-98262032 CAAGAGATGGAAAACAGGCCTGG - Intronic
1029248867 7:99221973-99221995 CCAAACATGGACACGGAGCCTGG - Intergenic
1030083026 7:105793705-105793727 CAAAACAGGGCAAAGCAGACAGG - Intronic
1030128762 7:106179257-106179279 CAAAAAATGGAAAATTAGCCAGG - Intergenic
1030362544 7:108610246-108610268 CAAAAAATAAAAAAGTAGCCAGG - Intergenic
1030616374 7:111742379-111742401 AAATACATGGGAAAGAAGCCTGG - Intronic
1031738492 7:125397494-125397516 CACTTCATGGAAAAGAATCCTGG - Intergenic
1031793142 7:126135522-126135544 AATAAAATGGAAAAGAAGCCCGG + Intergenic
1032144058 7:129362780-129362802 CAAAGCCAGGAAAAGAAGACAGG + Intronic
1032228700 7:130055189-130055211 AAAAACATGCAAAACAGGCCAGG + Intergenic
1032278281 7:130479497-130479519 CAAAACAAAAAAAAGTAGCCAGG - Intergenic
1032294833 7:130627221-130627243 CTAATCAGGGAAAAGAAGTCAGG + Intronic
1032756867 7:134899362-134899384 CTAAAAATGGAAAATTAGCCAGG - Intronic
1033334150 7:140438070-140438092 CAAAAAAGGGAAAAAAGGCCGGG + Intergenic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1034748013 7:153541233-153541255 CTAAAAATAGAAAAGTAGCCAGG - Intergenic
1034873976 7:154708750-154708772 AATAACATGGAAAAGCATCCAGG + Intronic
1035585744 8:772060-772082 CAAAAAATAGAAAATTAGCCAGG - Intergenic
1036000090 8:4592680-4592702 AAAAATAAGGAAAAGAGGCCGGG - Intronic
1036263065 8:7255498-7255520 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036264369 8:7263121-7263143 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036265664 8:7270743-7270765 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036266967 8:7278365-7278387 AAAAAGATGGAAAGGAAGACAGG + Intergenic
1036268272 8:7285987-7286009 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036269576 8:7293609-7293631 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036298317 8:7553446-7553468 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036299622 8:7561096-7561118 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036300926 8:7568742-7568764 AAAAAGATGGAAAAGAAGACGGG - Intergenic
1036302234 8:7576392-7576414 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036303525 8:7584036-7584058 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036315104 8:7714038-7714060 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036316412 8:7721684-7721706 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036317719 8:7729332-7729354 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036319028 8:7736980-7737002 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036320336 8:7744627-7744649 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036321644 8:7752275-7752297 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036322954 8:7759923-7759945 GAAAAGATGGAAAAGAAGACAGG + Intergenic
1036324256 8:7767572-7767594 AAAAAGATGGAAAAGAAGACAGG + Intergenic
1036351784 8:8016735-8016757 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036353085 8:8024381-8024403 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036354378 8:8032028-8032050 AAAAAGATGGAAAAGAAGACAGG - Intergenic
1036419470 8:8582650-8582672 AAAATAATGGAAAAGGAGCCAGG - Intergenic
1036555876 8:9860039-9860061 AAGAAAATAGAAAAGAAGCCGGG - Intergenic
1036868380 8:12419458-12419480 AAAAAGATGGAAAAAAAGACAGG - Intergenic
1038440083 8:27565507-27565529 CAAAACATGGGAATCAGGCCTGG + Intergenic
1038526223 8:28275960-28275982 CAGAACAGGAAAAAGGAGCCTGG - Intergenic
1038592274 8:28850581-28850603 AAACACATGGGAAAGAAGACAGG - Intronic
1038628063 8:29213651-29213673 CTAAACATAGAAAAGGGGCCAGG + Intronic
1038891842 8:31734163-31734185 CAAAAAATTAAAAAAAAGCCAGG + Intronic
1039562746 8:38526150-38526172 TAAAAAAAGGAAAAGAGGCCGGG - Intronic
1039621710 8:39003035-39003057 CAAAACATGCAAAATTAGCCAGG - Intronic
1040387544 8:46923768-46923790 CAATAAATGGAAAAGAAAGCTGG - Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040671842 8:49701133-49701155 TAAAACAGGGAAAAGTAGCTTGG + Intergenic
1041022021 8:53647825-53647847 CAAAAAATTAAAAAGTAGCCAGG - Intergenic
1041241288 8:55851105-55851127 AAAAAAACGGAAAAGAAGCGCGG - Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1042652032 8:71053545-71053567 TGAAACATGTAAAAGAAGTCTGG + Intergenic
1042690814 8:71496597-71496619 CAAAACATTGAAAAAAATGCTGG - Intronic
1042694126 8:71537748-71537770 AAACACATGGAAAATAATCCTGG - Intronic
1042906782 8:73779980-73780002 AAATATATGGAAAAGAAACCAGG + Intronic
1043264079 8:78240496-78240518 CCAGATATGGAAAAGAAGGCTGG + Intergenic
1043803815 8:84645509-84645531 GAAAACATGGAAAAGGAGAAAGG - Intronic
1043980395 8:86631827-86631849 CAAAACATAGAAAATAAAACAGG - Intronic
1044703504 8:94986032-94986054 AAAAACATGAAAAATTAGCCGGG - Intronic
1044741999 8:95337096-95337118 CGAAACATGGAAAGTAAGCAGGG - Intergenic
1044801327 8:95960045-95960067 AAAAACATGAAAAATTAGCCAGG + Intergenic
1045100803 8:98842374-98842396 CAAAACATGGAATAAAACCATGG + Intronic
1045344948 8:101285558-101285580 CAAAGCATGGACAAGAAGAAAGG - Intergenic
1045927476 8:107589302-107589324 CAAAATATCCAAAAGAAGACCGG + Intergenic
1046179541 8:110626019-110626041 CAAAAAATACAAAAGTAGCCGGG - Intergenic
1046740919 8:117828386-117828408 CAAAAAATGAAAAATTAGCCAGG + Intronic
1046745178 8:117868609-117868631 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1046748103 8:117897576-117897598 AAAAAAAGAGAAAAGAAGCCCGG - Intronic
1047099343 8:121658866-121658888 CAAAACATAGCAAACCAGCCAGG - Intergenic
1047192571 8:122691452-122691474 CAAAACATGGGAAAGCAGGATGG - Intergenic
1048809239 8:138270190-138270212 AAAAATATGGATAAGAAACCAGG + Intronic
1049019757 8:139947995-139948017 CAGAACGTGGACAAGAATCCAGG - Intronic
1049161803 8:141102840-141102862 AAAAGCATGGAAAAGAAGGCAGG - Intergenic
1049924717 9:397527-397549 AAAAATATGGAAAATTAGCCGGG + Intronic
1050257533 9:3810751-3810773 GACAACCAGGAAAAGAAGCCTGG - Intergenic
1051188753 9:14488200-14488222 CAAAACATTAAAAATTAGCCAGG + Intergenic
1051729290 9:20122786-20122808 CAAAACAAGGGCAAGAAGACAGG - Intergenic
1052980824 9:34448030-34448052 CAAAAAATTAAAAAGTAGCCAGG - Intronic
1053058945 9:35013670-35013692 CAAAAAATGGAAAAAAAGGAAGG + Intergenic
1053088583 9:35251258-35251280 CAAAAAATGGAAGAGTAGGCCGG - Intronic
1053403661 9:37851339-37851361 GAAAAAATGCAAAAGTAGCCAGG - Intronic
1055237117 9:74136040-74136062 CTAAATATGGAAAAGAAGACAGG - Intergenic
1055371787 9:75607429-75607451 CAAAACATAGTAAAAAGGCCGGG - Intergenic
1055526331 9:77137568-77137590 CAAAACATGGTAGAGAGGCCAGG + Intergenic
1055845890 9:80563381-80563403 AAAAAAATGGAAAAGAAGGAAGG + Intergenic
1056266489 9:84901766-84901788 ACATACATGGAGAAGAAGCCAGG - Intronic
1056448167 9:86686716-86686738 CAAAAAATGAAAAACAAGACTGG + Intergenic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1059193999 9:112353539-112353561 GAAAAAAAGGAAAAGAGGCCAGG - Intergenic
1059737698 9:117118695-117118717 AAAAAGATGGAAAAATAGCCTGG - Intronic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060124813 9:121033433-121033455 CATAACAATGAAAAGAAGCCAGG + Intronic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1062063957 9:134515945-134515967 AAAAACATGAAAAAATAGCCAGG + Intergenic
1062377904 9:136272357-136272379 TAAAACATTTAAAATAAGCCTGG + Intergenic
1185479252 X:433858-433880 CAGAAAGTGGAAACGAAGCCCGG - Intergenic
1185492032 X:525173-525195 CAAAAGATGGAAAAAAACCAAGG + Intergenic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1185596724 X:1311592-1311614 CAAAACAAAAAAAAGTAGCCGGG - Intergenic
1186011817 X:5142824-5142846 CTAAACATAAAAAAGCAGCCGGG + Intergenic
1186065762 X:5762607-5762629 CAAAACAGGAAAGAGGAGCCGGG + Intergenic
1186169065 X:6858147-6858169 CAAAACATGGATAAGAACTCTGG + Intergenic
1186348425 X:8718381-8718403 CAAAACATGGAAAAGAAAATGGG + Intronic
1186524939 X:10239693-10239715 AAAAATATGGAAAATTAGCCGGG - Intergenic
1187385938 X:18848396-18848418 CAAAACCTGGAAAATTAGCTAGG + Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1188493896 X:30763720-30763742 CAAAACATACAAAATTAGCCGGG + Intergenic
1188974641 X:36658469-36658491 CAAAACTTGGACAAGGAGCTTGG + Intergenic
1189362227 X:40361824-40361846 CAAAATATTCAAAAGAGGCCAGG - Intergenic
1189404804 X:40711781-40711803 CAAAAAAAAAAAAAGAAGCCTGG - Intronic
1189466150 X:41279051-41279073 CAAAACATCAAAAATTAGCCAGG - Intergenic
1190377279 X:49801300-49801322 TAAGAAATGGAAAAGAAGGCTGG + Intergenic
1190724480 X:53179475-53179497 AAAAACAGGCAAAAGAAGCCTGG + Intergenic
1190788629 X:53678906-53678928 CAAGACATGGAACTGAAGTCAGG + Intronic
1190955289 X:55187044-55187066 AAAAACAGGGAAAACAAGCCAGG - Intronic
1191252845 X:58267630-58267652 GGAAACATGAAAAGGAAGCCAGG - Intergenic
1192046330 X:67677994-67678016 CAAAACAGAGACAAGAATCCAGG - Intronic
1192218244 X:69178823-69178845 CCAGACAAGGAAAGGAAGCCAGG - Intergenic
1192805029 X:74501220-74501242 CAAAACCTGAATCAGAAGCCTGG - Intronic
1193076235 X:77359157-77359179 CAGAATTTGGAACAGAAGCCAGG - Intergenic
1193149619 X:78111243-78111265 AAAAATATGAAAAAGTAGCCAGG - Intronic
1193217633 X:78883295-78883317 CTAAATATGGAAAAGAAAACTGG - Intergenic
1195205595 X:102597087-102597109 CAAAAAAGAGAAATGAAGCCTGG + Intergenic
1195457341 X:105083818-105083840 CTAAACATGGAAAAGAAGACCGG + Intronic
1195654122 X:107318360-107318382 CAAAGCATGTAGAAGAATCCTGG + Intergenic
1195688668 X:107606479-107606501 CAAAGCATTGAAGAGGAGCCAGG + Intergenic
1195833169 X:109083093-109083115 CAAAAAAGGGAACAGATGCCAGG - Intergenic
1196526247 X:116730235-116730257 TAAAACATGGAAAAGAATAATGG + Intergenic
1196693175 X:118582309-118582331 CAGAACATGGATCAGAACCCAGG + Intronic
1197033923 X:121852475-121852497 CAAAACACAGAAAAAAATCCAGG - Intergenic
1197128885 X:122980626-122980648 CAGAAGATGAAAAAGAAGACAGG + Intergenic
1197177174 X:123498493-123498515 AAAAAAATGGAAAAAAGGCCAGG - Intergenic
1197556260 X:127958660-127958682 AAAAACAAGAAAAAGTAGCCAGG + Intergenic
1197934895 X:131729843-131729865 CAAAAAAGAGAAAAGGAGCCGGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198805018 X:140485459-140485481 CTAAACATGGAAAATTAGTCAGG + Intergenic
1199034661 X:143035513-143035535 CAAAACATGGACCAGAAGGTGGG - Intergenic
1199092682 X:143710529-143710551 CAAAACATGGACCAGAAGGTGGG + Intergenic
1199224086 X:145352207-145352229 CACAACATGGAAACCAACCCAGG + Intergenic
1199854258 X:151747390-151747412 CACTAAATGTAAAAGAAGCCTGG - Intergenic
1200141081 X:153903337-153903359 AAAAACATGGCAAAGATGCGGGG + Intronic
1200843378 Y:7806541-7806563 CATAACAGGGAAAAGCAACCAGG - Intergenic
1201331556 Y:12827798-12827820 CAAAAAATAGAAAACTAGCCAGG + Intronic
1201417398 Y:13761123-13761145 CAAAACATGGAAAAGGAAATGGG - Intergenic
1201559425 Y:15300460-15300482 CCAAACATGGATAAGAACTCTGG + Intergenic
1202327929 Y:23712078-23712100 CAAAACATCAATAAAAAGCCAGG + Intergenic
1202542841 Y:25957974-25957996 CAAAACATCAATAAAAAGCCAGG - Intergenic