ID: 1057855752

View in Genome Browser
Species Human (GRCh38)
Location 9:98599629-98599651
Sequence TACTGTGTCTGAGGGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057855752_1057855762 7 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855762 9:98599659-98599681 GTGCTGACGGGCTCTGAGCAGGG No data
1057855752_1057855763 14 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855763 9:98599666-98599688 CGGGCTCTGAGCAGGGCATGCGG No data
1057855752_1057855764 15 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855764 9:98599667-98599689 GGGCTCTGAGCAGGGCATGCGGG No data
1057855752_1057855759 -6 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855759 9:98599646-98599668 ACAGTATGCAGTGGTGCTGACGG No data
1057855752_1057855761 6 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855761 9:98599658-98599680 GGTGCTGACGGGCTCTGAGCAGG No data
1057855752_1057855760 -5 Left 1057855752 9:98599629-98599651 CCCCAGGCCCCTCAGACACAGTA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1057855760 9:98599647-98599669 CAGTATGCAGTGGTGCTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057855752 Original CRISPR TACTGTGTCTGAGGGGCCTG GGG (reversed) Intronic
900139213 1:1132453-1132475 CCCTTTGTCTGAGGAGCCTGCGG + Intergenic
900146972 1:1162688-1162710 GACGGAGTCTGCGGGGCCTGCGG + Intergenic
901388408 1:8926327-8926349 TTCTATGTCTGAGAGGCCGGGGG - Intergenic
901659865 1:10792336-10792358 TACTTTGTGTGCGGGGCCGGGGG - Intronic
901781355 1:11596885-11596907 TGTTGAGTCTGAGGGCCCTGGGG + Intergenic
902878463 1:19355048-19355070 TCCTGTGTCAGAGGGGCTGGAGG - Intronic
902929649 1:19721901-19721923 GACTCTATCTGAGGGGCCAGCGG + Intronic
903771606 1:25767816-25767838 TAGTGTGTGTGAGGGGAGTGTGG - Intronic
904937414 1:34141449-34141471 TACTGTGGATGAGGGGGTTGAGG + Intronic
905312834 1:37062356-37062378 TACTTTCTCTGGGGTGCCTGTGG + Intergenic
905423263 1:37862919-37862941 TGCTGTGTCAGAGGTGGCTGAGG + Intronic
905510776 1:38518005-38518027 TGCTTTGTCTGAGGGCTCTGTGG + Intergenic
906085215 1:43127195-43127217 TACTTTTTTTGAGTGGCCTGAGG + Intergenic
906087535 1:43148635-43148657 TGCTGGGTCTGAGGTGCCTGTGG - Intronic
906482935 1:46212171-46212193 TACTGTGTTTGTGTGACCTGCGG + Intronic
906513389 1:46424120-46424142 CCCTGTGTCTGCGGGGGCTGGGG - Intergenic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
908278640 1:62504710-62504732 TACAGTGTCGGAGAAGCCTGAGG + Exonic
909727546 1:78853606-78853628 TACTGTGACTGAGTGGAGTGAGG + Intergenic
910792780 1:91068300-91068322 GTTTGTGTCTGAGGGGCTTGTGG + Intergenic
915342865 1:155185758-155185780 GAATGTGTGTGAGGGGGCTGGGG - Intronic
915836150 1:159177067-159177089 TACTGTCTCTGAGGGGGCACAGG + Intronic
916125314 1:161565248-161565270 TTCTGCGTTTGAGGTGCCTGTGG + Intergenic
916135202 1:161646638-161646660 TTCTGCGTTTGAGGTGCCTGTGG + Intronic
917742452 1:177974201-177974223 TGCTGAATGTGAGGGGCCTGTGG + Intronic
918299340 1:183188344-183188366 GACCGTGTCTGAGTGTCCTGTGG + Intronic
919662543 1:200261470-200261492 TACTGTGTACCAGGGGACTGAGG - Intergenic
922107331 1:222523887-222523909 CACTGTCTCTCAAGGGCCTGAGG - Intronic
1063548097 10:7001459-7001481 AGCTGTGCCTGAGGGGCCCGAGG + Intergenic
1064119463 10:12606247-12606269 TGCTGTGTGTGAGGGGCCCATGG - Intronic
1064933233 10:20650757-20650779 TGCTGTGTCTGGGGAGTCTGTGG - Intergenic
1065743191 10:28815574-28815596 TCCTGAGTCTGATGGGGCTGTGG - Intergenic
1067565575 10:47334150-47334172 AACTGTGTCTGAGGATGCTGTGG + Intergenic
1068738437 10:60440946-60440968 TACTGAGTTTGAGGAGCTTGTGG + Intronic
1069567770 10:69474926-69474948 TACTGAGTCAGCGGGGTCTGGGG + Intronic
1070218681 10:74416079-74416101 TACCGTGTTTGAGGGTCATGAGG + Intronic
1070382800 10:75896496-75896518 TGGTGTGTCACAGGGGCCTGTGG + Intronic
1070659836 10:78297397-78297419 AACAGTGTCTAAGAGGCCTGTGG - Intergenic
1074727304 10:116324819-116324841 GACGGTGTCTGAGGGGTCTGAGG - Intronic
1075020792 10:118950656-118950678 CACTGTGCCTGAAGGGTCTGAGG - Intergenic
1075064486 10:119280250-119280272 TGCTTTGTCTGAGTGTCCTGAGG + Intronic
1075203129 10:120422886-120422908 CACAGAGTGTGAGGGGCCTGTGG + Intergenic
1075443122 10:122494834-122494856 CACTGCGGGTGAGGGGCCTGGGG + Intronic
1078417704 11:11179487-11179509 TACTGTCTGTGAGTGCCCTGTGG - Intergenic
1080766995 11:35306131-35306153 GACTGTGACTGAGGTGCCGGAGG - Exonic
1082984573 11:59157428-59157450 TAATGAGTCTGAGTGGCCAGAGG + Intergenic
1084582493 11:70032605-70032627 AACAGTGTCTGAGTGGCCAGTGG + Intergenic
1086315526 11:85587994-85588016 TACTGTGTTTGAGGAGGCTAAGG + Intronic
1088712996 11:112525048-112525070 TACTGTGTGTCAGCTGCCTGAGG + Intergenic
1090234756 11:125139251-125139273 TTCTGTGTTTGAGGAGCCTGTGG + Intergenic
1091687726 12:2575406-2575428 TATTGTGTCTTAAGGGGCTGGGG + Intronic
1092240001 12:6830463-6830485 TGCTGACTGTGAGGGGCCTGAGG + Exonic
1096115675 12:49053606-49053628 TGCAGTGTGTGAGGGGCCAGGGG - Exonic
1097019520 12:56009966-56009988 TACTGTGTGTGGGGGGGCAGGGG - Intronic
1099303240 12:80923297-80923319 TCCTGGTTCTGAGGGGCCTGTGG + Intronic
1100096207 12:91040520-91040542 AGCTGTGACTAAGGGGCCTGAGG - Intergenic
1101662713 12:106780079-106780101 AACTGTGACTAAGGGCCCTGAGG + Intronic
1104103612 12:125638422-125638444 TACTGTGTCTGAGGCGCAGTAGG - Intronic
1104954250 12:132456762-132456784 TGGTGTGGCTGAGGGTCCTGTGG + Intergenic
1105270670 13:18872330-18872352 TACTGTGTCTTAGGGTTTTGGGG - Intergenic
1105979903 13:25508292-25508314 TAATGAGTCTGAGGGTCATGTGG - Intronic
1106232288 13:27830069-27830091 TCCTGGGTCCGTGGGGCCTGCGG - Intergenic
1106263474 13:28089678-28089700 TACTGGTTGTGAGGGGCTTGGGG + Intronic
1107315750 13:39129880-39129902 TACTGAGTTTGATGTGCCTGTGG - Intergenic
1108536366 13:51384578-51384600 TATTGTGTCTGAGGAACCTGTGG - Intronic
1108921638 13:55681912-55681934 TACTGTTTCTCTGGTGCCTGAGG + Intergenic
1109522159 13:63527722-63527744 TACTTTTTTTGAGAGGCCTGAGG + Intergenic
1112262373 13:97888680-97888702 ATCTGTGTCTGGTGGGCCTGGGG + Intergenic
1112430876 13:99349287-99349309 TGCTGTGTGTCAGGGGCCAGTGG - Intronic
1113613795 13:111666401-111666423 TACTGGGAGTGAGGGGCCTCTGG - Intronic
1117141200 14:52792075-52792097 AACTGTGACTCAGAGGCCTGGGG - Intergenic
1117424977 14:55584703-55584725 TACTGTGTTTGAGGGTTATGTGG - Intronic
1117436713 14:55722083-55722105 TACTGTATCTATGTGGCCTGAGG + Intergenic
1119606353 14:76021222-76021244 TACAGTGTCTAAGAGGCTTGGGG - Intronic
1119704348 14:76774617-76774639 TGCTGTGCCTGAGGGAGCTGTGG - Intronic
1121519561 14:94576795-94576817 TAGTGAGCCTGAAGGGCCTGTGG - Intronic
1121624519 14:95374500-95374522 AGCTGTGTGTCAGGGGCCTGGGG + Intergenic
1122986960 14:105216912-105216934 TGCTGCGTCTTGGGGGCCTGTGG - Intronic
1123071406 14:105644255-105644277 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1123096836 14:105770871-105770893 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1124111655 15:26795696-26795718 TACTGTGTCTGAAACGACTGTGG + Intronic
1128063875 15:64752244-64752266 TTTTTTGTCTGAGGGGCCAGTGG - Intronic
1128501284 15:68229299-68229321 TTCTCTGTCTGGGGAGCCTGGGG - Intronic
1128687072 15:69694768-69694790 AACTGTTTCTGAGGGGGCTGTGG + Intergenic
1128730227 15:70015779-70015801 TCCAGTCTCTAAGGGGCCTGAGG + Intergenic
1129161057 15:73748165-73748187 AACTGAGGCTGAGGGACCTGGGG + Intronic
1129251281 15:74310570-74310592 GACCGACTCTGAGGGGCCTGAGG + Intronic
1129887032 15:79045738-79045760 TGCTGAGTTTGAGGGGACTGTGG - Intronic
1130446481 15:84006895-84006917 TACGGAGTTTGAGGTGCCTGTGG + Intronic
1131823889 15:96300928-96300950 TATTTTGTGTCAGGGGCCTGTGG + Intergenic
1132579469 16:678422-678444 TGCTGTGTCTGTGGGAGCTGGGG + Intronic
1132810035 16:1793037-1793059 GGCTGGGTCTGTGGGGCCTGTGG - Intronic
1132866927 16:2097667-2097689 CACTGTGTCTGGGGTGCCGGGGG - Intronic
1132906232 16:2284170-2284192 CTCTGCGTCTGAGTGGCCTGGGG - Intronic
1136640795 16:31563553-31563575 TACAGTGTCAGAGAGGCCTTTGG + Intergenic
1136779035 16:32885731-32885753 TCCTGTGTGTCAGGGGCCCGGGG + Intergenic
1136891583 16:33975787-33975809 TCCTGTGTGTCAGGGGCCCGGGG - Intergenic
1137613801 16:49835511-49835533 CCCTGTCTCTGAGGGGTCTGTGG - Intronic
1139282732 16:65784418-65784440 TAGTGTGTGTGAGGAGCCTTGGG - Intergenic
1139915721 16:70427313-70427335 GACTGGGTTTGAGGGGCTTGAGG - Intronic
1140657034 16:77151646-77151668 TGATGTGTCTGAGAGGACTGGGG - Intergenic
1142228398 16:88888432-88888454 CTCTGTGTCTGAAGGGGCTGCGG + Intronic
1203081448 16_KI270728v1_random:1147820-1147842 TCCTGTGTGTCAGGGGCCCGGGG + Intergenic
1144620809 17:16817355-16817377 ACCTGTGCCTGTGGGGCCTGGGG + Intergenic
1147572199 17:41578258-41578280 ACCTGTGCCTGTGGGGCCTGGGG + Intergenic
1147649391 17:42053484-42053506 AACTGCCTCTGAGGGGCCAGGGG - Intronic
1147725198 17:42562564-42562586 GACGGTGACTGAAGGGCCTGCGG - Intronic
1149310359 17:55387065-55387087 TACTGTGTTTGGGATGCCTGAGG - Intergenic
1151612373 17:75184580-75184602 TGCTGGGTCTGAGGTGCCTCTGG - Intergenic
1153535647 18:6098844-6098866 TACTGTGTCTGGGTGGGCCGGGG + Intronic
1154232695 18:12572084-12572106 TACTGAGTATGAGGGACCAGAGG + Intronic
1156391148 18:36651860-36651882 TACTGTGTGTGGAGGGACTGAGG + Intronic
1158003304 18:52644126-52644148 TACTGTGTCTGTTTGGGCTGTGG + Intronic
1158135518 18:54203702-54203724 TACATTTTCTGAGGGGCATGGGG - Intronic
1161648099 19:5466870-5466892 TGCTGGGTCTGAGGGGTCAGAGG + Intergenic
1161657754 19:5526262-5526284 TGCTGTGTGTGAGAAGCCTGAGG + Intergenic
1162087924 19:8259689-8259711 TGCTGGGTTTGAGGGGTCTGTGG + Intronic
1162110468 19:8397187-8397209 TTCTGGGTATGAGGGGCCTGGGG + Intronic
1162434636 19:10650121-10650143 TACTGTGTTTGGGGTCCCTGGGG + Intergenic
1163299627 19:16435865-16435887 AGCTGGGACTGAGGGGCCTGGGG - Intronic
1163860538 19:19740566-19740588 TGCTGAGGGTGAGGGGCCTGTGG - Intergenic
1166294295 19:41881414-41881436 TCCTGGGTCTGAGGGACATGTGG - Intergenic
1166676996 19:44746838-44746860 TCCTGTGTCTGAGGGTCCCCAGG + Intergenic
1166818362 19:45560785-45560807 TAGAGTGTCTGAAGTGCCTGTGG - Intronic
1167135706 19:47614006-47614028 TACTGTGTGACAGGGCCCTGGGG + Intronic
1167669010 19:50839033-50839055 TCCTGGGTCTGAGGGAGCTGGGG + Intergenic
1168103599 19:54153709-54153731 TACTGTGCCTTAGTGCCCTGGGG - Exonic
926373093 2:12200063-12200085 TAATGTGGCTGATGGGTCTGTGG + Intergenic
928060044 2:28102834-28102856 TACTGTGTCAGAGAGGGCAGTGG - Intronic
928285891 2:29989735-29989757 AACTGTGCCTCAGGGGCCTCTGG - Intergenic
929044954 2:37780203-37780225 TGCTCAGTCTGAGGTGCCTGTGG - Intergenic
930065084 2:47321753-47321775 TGCTGTGGCTCAGGGGGCTGGGG + Intergenic
931156308 2:59634744-59634766 CACTTTACCTGAGGGGCCTGGGG - Intergenic
933073475 2:77891975-77891997 GACCTTGTCTTAGGGGCCTGTGG - Intergenic
934985348 2:98881105-98881127 TTCTGTGTCTGGGGAGGCTGTGG + Intronic
935563614 2:104584133-104584155 TACTGAGCCAGAGGGGGCTGGGG + Intergenic
935572415 2:104675981-104676003 AACTGTGTCTGTGGGGTCTCAGG - Intergenic
937444689 2:121947848-121947870 ATCTGTGTCTGAGCGGCCTTGGG + Intergenic
937603944 2:123774237-123774259 TCCTTTGTCTAAGGAGCCTGTGG + Intergenic
939282555 2:140083479-140083501 ATCTGTTTCTGAAGGGCCTGAGG + Intergenic
940856078 2:158729662-158729684 TCCTGTGGTAGAGGGGCCTGGGG + Intergenic
945787366 2:214258681-214258703 AACAGTGTCTCAGGAGCCTGTGG - Intronic
946041299 2:216784974-216784996 TACTCTCTCTGAGGGGCCTCAGG + Intergenic
948589425 2:239039661-239039683 TTCTGTGTCTGCGTGGGCTGAGG + Intergenic
1169502757 20:6176947-6176969 TACTGAGACTGAAGGGGCTGAGG + Intergenic
1170113316 20:12828912-12828934 TACTGTGTTTGAGGAGTATGCGG + Intergenic
1170369612 20:15634760-15634782 TACTGTGCCACAGGGGCTTGAGG + Intronic
1171119134 20:22553125-22553147 TACTGTGTCTGAGGGGATGATGG + Intergenic
1172191413 20:33064024-33064046 TGCTGTGGCTGCGGGGCCTTGGG - Intronic
1172944753 20:38678467-38678489 TGCTGAGGCAGAGGGGCCTGGGG - Intergenic
1173190881 20:40874915-40874937 TGCAGAGTCTGAGGGGACTGCGG + Intergenic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1174295491 20:49542408-49542430 AACTGTGTCTTCAGGGCCTGAGG - Intronic
1174410437 20:50331541-50331563 TGCTCTGTCTAATGGGCCTGTGG - Intergenic
1174429201 20:50455873-50455895 TACTGGGGCTGAGGGCCCCGGGG - Intergenic
1175069891 20:56324457-56324479 TACTGTATCTGTGGGGGGTGTGG - Intergenic
1175161540 20:57011612-57011634 TGCTGGGTTTGAGGGGCCTGAGG - Intergenic
1175507403 20:59495623-59495645 TCCTGGGTCAGAGGGGACTGAGG - Intergenic
1175549614 20:59808657-59808679 TCCAGTGACTCAGGGGCCTGGGG - Intronic
1175936337 20:62515815-62515837 TACTGGCTCAGAGGTGCCTGGGG + Intergenic
1176037247 20:63045622-63045644 TTCAGTGTCTGCTGGGCCTGGGG - Intergenic
1176855946 21:13971636-13971658 TACTGTGTCTTAGGGTTTTGGGG - Intergenic
1179382345 21:40911176-40911198 TACTGTATCAGAGCTGCCTGGGG - Intergenic
1180784673 22:18540142-18540164 TCCTGAGGCTGAGGGGCCCGGGG - Intergenic
1180981006 22:19877934-19877956 CGCCCTGTCTGAGGGGCCTGAGG + Intronic
1181128251 22:20714194-20714216 TCCTGAGGCTGAGGGGCCCGGGG - Intronic
1181241576 22:21479499-21479521 TCCTGAGGCTGAGGGGCCCGGGG - Intergenic
1181403811 22:22667869-22667891 GACTGAGTCTGAGGGACCAGGGG + Intergenic
1181406134 22:22686305-22686327 GACTGAGTCTGAGGGACCAGGGG + Intergenic
1182476008 22:30576711-30576733 AACTGTGTGGGAGGGGGCTGTGG + Exonic
1182896217 22:33861541-33861563 TTCTGTGGGTGAGGAGCCTGAGG - Intronic
1183035044 22:35134958-35134980 TACTCAGGCTGAGGGGCCTGCGG - Intergenic
949911416 3:8911973-8911995 TATTGTTACTGAGTGGCCTGAGG + Intronic
950395540 3:12731292-12731314 AGGTGTCTCTGAGGGGCCTGAGG - Intergenic
951920546 3:27849697-27849719 TACTGTGGCTATGGGGGCTGTGG + Intergenic
953250996 3:41245800-41245822 TACTGTGTCAGAGGGGCTGTTGG + Intronic
953669040 3:44947260-44947282 TGCTGAGTCTGAAGTGCCTGAGG + Intronic
954611279 3:51945747-51945769 TCCTGTGTCTCCAGGGCCTGAGG + Intronic
957127747 3:76184263-76184285 GACTATGTGTGAGGAGCCTGTGG - Intronic
957572194 3:81961298-81961320 TATTGTGTCTGTTGGGGCTGGGG - Intergenic
958859119 3:99423906-99423928 TCCTGTGTCTTAAGGCCCTGGGG + Intergenic
962747150 3:138405251-138405273 TAACATGTCTGAGGGGCCTTTGG - Exonic
962805222 3:138922317-138922339 TGGTGTGTCTGAGGGGACTTGGG - Intergenic
963908856 3:150797727-150797749 TACTGTGGCTGAGTGGTCTTAGG + Intergenic
968086730 3:195877236-195877258 TACTGAGACTGCAGGGCCTGTGG - Intronic
968540197 4:1164443-1164465 GACTGGGGCTGAGGGGTCTGTGG - Intergenic
968619931 4:1599461-1599483 TCCCGTGGCTGTGGGGCCTGGGG - Intergenic
969444080 4:7234218-7234240 TGCTGGGTCTGAGCTGCCTGGGG + Intronic
979832908 4:125322536-125322558 GAATGTCTTTGAGGGGCCTGGGG - Intronic
980340612 4:131540478-131540500 CACTGGGTGTGAGCGGCCTGCGG + Intergenic
981363463 4:143874295-143874317 TTCTGTGGGTGAGGGGGCTGTGG - Intronic
981374203 4:143995089-143995111 TTCTGTGGGTGAGGGGGCTGTGG - Intergenic
984035976 4:174668153-174668175 TTCTGTTTCTGGGGGGCCTCAGG - Intronic
984750203 4:183265048-183265070 TGCTGTGTCTGATGAGTCTGTGG + Exonic
985671061 5:1206892-1206914 AGCTGTGGCTGAAGGGCCTGGGG - Intronic
985903464 5:2814680-2814702 GACTGTGTCTGAGTGGTCTTGGG - Intergenic
986205144 5:5617119-5617141 TACTCTGTCTGATTGGGCTGTGG - Intergenic
988128331 5:27072755-27072777 TACTGTGGAAGCGGGGCCTGCGG - Intronic
988466318 5:31495910-31495932 TCCTGTGGGTGATGGGCCTGGGG + Intronic
994145662 5:96392329-96392351 CACTGTGTCTGTGGTGCCAGAGG - Exonic
995924033 5:117347646-117347668 GACAGTGTGTGAGAGGCCTGAGG - Intergenic
996838712 5:127822854-127822876 CACTGGGCCTCAGGGGCCTGAGG - Intergenic
1000998327 5:167981168-167981190 TGCTGTGGCAGAGGGGCCTATGG - Intronic
1002039897 5:176505300-176505322 AACTGTGTGTGAGATGCCTGTGG - Intronic
1002136603 5:177111732-177111754 CAGTGTGTTTCAGGGGCCTGAGG + Intergenic
1002284212 5:178151513-178151535 TTCTGTGTCTTAGGCTCCTGAGG - Intronic
1004746663 6:18515670-18515692 TTCTGTGTGTCAGGGGCATGTGG + Intergenic
1005401357 6:25437620-25437642 TACTGAGTGTGAGGTGCCTGGGG - Intronic
1007002576 6:38328389-38328411 TCCTCTGTCTGAGTGGCCTGTGG - Intronic
1007168648 6:39847023-39847045 GACTGTGCCTGTGGGTCCTGAGG + Intronic
1007249800 6:40487989-40488011 TGCTGTGACTGGGGAGCCTGGGG - Intronic
1008982218 6:57497775-57497797 TAATGTGTGTGAGAGCCCTGTGG + Intronic
1009170283 6:60390611-60390633 TAATGTGTGTGAGAGCCCTGTGG + Intergenic
1012838712 6:104302188-104302210 TACGGTGTCTGAGTGCTCTGTGG - Intergenic
1013073119 6:106746999-106747021 TAGTGTGACTGAGGGGTCAGTGG - Intergenic
1015551376 6:134415661-134415683 AACTGTGTGTGAGGGGAGTGGGG + Intergenic
1016452648 6:144198934-144198956 TACTGAGTTTGAGGAACCTGTGG - Intergenic
1020193781 7:6021138-6021160 TACTGTGTGTAATGAGCCTGGGG - Intronic
1020632553 7:10656972-10656994 TGTTGTGTGTGAGGGGGCTGAGG + Intergenic
1022769410 7:33453385-33453407 TACTGTCTCTGAGGTGGCAGAGG - Intronic
1032991136 7:137396105-137396127 TGCTGTGCCTGAAGGGCCAGAGG - Intronic
1035038801 7:155912772-155912794 TACTGTGTATGATGAGCATGTGG + Intergenic
1037328742 8:17722197-17722219 TACTGTGTCTGATGCTCCTAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1040645233 8:49389414-49389436 TCCTGTGGGTGAGGGGTCTGGGG - Intergenic
1042717390 8:71789523-71789545 TAATGACTGTGAGGGGCCTGAGG + Intergenic
1045649224 8:104327050-104327072 TACTCTTCCTGAGGGGCCTCAGG - Intergenic
1047335861 8:123935584-123935606 TGCTGTCTCTGAGGGGCTTCTGG + Intronic
1048436855 8:134426238-134426260 AGTTGTTTCTGAGGGGCCTGGGG - Intergenic
1050424950 9:5502873-5502895 TGCTATGTTGGAGGGGCCTGAGG - Intergenic
1055126206 9:72720502-72720524 TAGTGTGGCTAAGGGGACTGAGG + Intronic
1055425799 9:76195155-76195177 TTGTGTGTCAGAAGGGCCTGTGG - Intronic
1057220149 9:93253124-93253146 TACCTGGTCTGAGGGCCCTGAGG + Intronic
1057855752 9:98599629-98599651 TACTGTGTCTGAGGGGCCTGGGG - Intronic
1058070643 9:100597874-100597896 TGCTAAGTCTGAGGTGCCTGTGG + Intergenic
1061258327 9:129465654-129465676 CACTGTGACTCAGCGGCCTGGGG + Intergenic
1061418811 9:130462263-130462285 CACTGGGACTGGGGGGCCTGGGG - Intronic
1061679378 9:132235538-132235560 TGCTGCTTCTAAGGGGCCTGTGG + Intronic
1062283969 9:135764926-135764948 GACTGTCTGTTAGGGGCCTGGGG - Intronic
1062316795 9:135971389-135971411 TAATTTGTCACAGGGGCCTGGGG + Intergenic
1062496452 9:136833660-136833682 GACTGGGTCTGGGGGACCTGGGG + Intronic
1189355119 X:40304610-40304632 CACTGTGCCAGAGGGGCCTTGGG + Intergenic
1190290356 X:48988364-48988386 GACTGTGTCTGAGGCCCCTGAGG - Intronic
1192358597 X:70424891-70424913 TAGTGTATCTGAGGAGCCCGGGG - Intronic
1195020690 X:100824231-100824253 GACTGGGCCTGAGGGGCCTGAGG - Exonic
1198791788 X:140354351-140354373 TGCTGTGTCTGTGGGGAGTGGGG - Intergenic
1199843572 X:151674737-151674759 AATTGTGTGTGGGGGGCCTGCGG - Intronic