ID: 1057856070

View in Genome Browser
Species Human (GRCh38)
Location 9:98601744-98601766
Sequence GACCAGCCCTTGGCCCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057856070_1057856072 -5 Left 1057856070 9:98601744-98601766 CCAGTATGGGCCAAGGGCTGGTC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1057856072 9:98601762-98601784 TGGTCATTGTGAATGTTTCCTGG No data
1057856070_1057856074 16 Left 1057856070 9:98601744-98601766 CCAGTATGGGCCAAGGGCTGGTC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1057856074 9:98601783-98601805 GGTTTGTTCCCATCTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057856070 Original CRISPR GACCAGCCCTTGGCCCATAC TGG (reversed) Intronic
900520987 1:3105411-3105433 GACCAGCCCCTGGCCCAGAGAGG - Intronic
903772932 1:25775405-25775427 CACCAGCCCTGGGCCCTGACAGG + Intronic
906692501 1:47801823-47801845 CTCCAGCCCTTTGCCCACACAGG + Intronic
907335787 1:53698591-53698613 CACCAGCCCTTGGCCAAGCCAGG + Intronic
914224817 1:145711752-145711774 GACCAGACCTTGGTACATGCAGG - Intergenic
915546349 1:156600767-156600789 GACCAGCCCCTGGCCAATATGGG - Intronic
916675800 1:167063581-167063603 GAGCAGCCCCTGGCCCAGCCAGG - Exonic
916792330 1:168136071-168136093 GACCAGCCCTCGGCGCCTTCTGG - Intronic
922045876 1:221945911-221945933 GAAGAGCCCTTGGGCCTTACAGG - Intergenic
1067512407 10:46906859-46906881 GACCATTCCTCGGCCCATCCAGG - Intergenic
1067649837 10:48144963-48144985 GACCATTCCTCGGCCCATCCAGG + Intergenic
1067748144 10:48952075-48952097 GGGCAGCACTTGGCCCATCCTGG + Intronic
1069869926 10:71526908-71526930 GCCCAGCCCTTGGTCAATAGAGG - Intronic
1070721228 10:78758512-78758534 GAGCAGCCCCTGCCCCACACGGG - Intergenic
1071046659 10:81387395-81387417 GAACAGCCCTTGGACCTTAAGGG - Intergenic
1093761373 12:22915166-22915188 GACCAGACTTTGACCAATACTGG - Intergenic
1094375973 12:29787640-29787662 GCCCAGACCTGGGCCCAGACTGG + Intergenic
1095190264 12:39250185-39250207 GACCTGCCATTGGCCCTTAATGG + Intergenic
1096660255 12:53119671-53119693 CTCCAGGCCTTTGCCCATACTGG + Intronic
1102059540 12:109922430-109922452 GAACAGCCTGTGGCCCACACTGG + Intronic
1118040196 14:61908098-61908120 GACCAGCCTTTGGCCTTTAAAGG + Intergenic
1120172828 14:81263178-81263200 GTCCAACCCTTGGCCCATGATGG + Intronic
1121522854 14:94598334-94598356 GACCACCTCTTGGGCCATGCAGG + Intronic
1122043474 14:99007169-99007191 GCCCAGCTCTTGGCCCACACTGG + Intergenic
1122798563 14:104218463-104218485 GACCTGCCACTGGCCCAGACAGG - Intergenic
1124153852 15:27208289-27208311 GACCAGGCCTTGGCTCAAAATGG - Intronic
1124624722 15:31301267-31301289 GCCCTGCCCTTGCCCCACACAGG - Intergenic
1125522287 15:40354920-40354942 GAGCAGCCCCTGCCCCATCCAGG - Intronic
1127930609 15:63594786-63594808 GGCCATCACTTTGCCCATACAGG - Intergenic
1128203454 15:65829795-65829817 GACCAACCATTGACTCATACTGG + Intronic
1128301814 15:66570692-66570714 GACCTGCCATTGTCCCATGCTGG + Intergenic
1128741512 15:70087145-70087167 GAGCAGTGCCTGGCCCATACTGG - Intronic
1128782847 15:70374325-70374347 GGCCAGCCCTTGCCCCATGATGG - Intergenic
1131214703 15:90527470-90527492 TACCAGCTCTTGAACCATACAGG - Intergenic
1134105882 16:11485785-11485807 GACCAGCCCTTGGCAATGACTGG + Intronic
1139371139 16:66470135-66470157 GACCAGCCCTTGGTGCAGCCTGG - Intronic
1139597500 16:67966910-67966932 GGCCACGCCTTGGCCCCTACAGG - Intronic
1140302674 16:73773452-73773474 GACCAGGGCCTGGCTCATACTGG - Intergenic
1141000785 16:80305865-80305887 TAGCAGCACTTGGCACATACAGG - Intergenic
1141944358 16:87299129-87299151 GAGCAGCCCTTGGCCGATGATGG - Intronic
1142978034 17:3656800-3656822 GACCAGCCCTGGCCCCCCACAGG + Intronic
1143724976 17:8838591-8838613 GACCAGCACTGGGCTCTTACCGG + Exonic
1149932552 17:60770203-60770225 GAGAACCCCTTGACCCATACAGG - Intronic
1151508572 17:74544558-74544580 GACCAGCCCTAGGCTCAGGCAGG + Intronic
1151509842 17:74551575-74551597 GACCAGCCCTAGACTCAGACAGG + Intergenic
1152504694 17:80741189-80741211 GAATAGCGCTTGGCCCACACTGG + Intronic
1157635479 18:49149290-49149312 CAACAGCCCATGGACCATACTGG + Intronic
1160814228 19:1027927-1027949 GACCAGCTCTTGGCCAAAAAGGG + Intronic
1161643282 19:5436990-5437012 GTCCAGCCCCTGGACCCTACTGG - Intergenic
928480257 2:31675897-31675919 AACCACCCCCTGGCCCCTACAGG - Intergenic
929828014 2:45325096-45325118 CACCACCCATTGGGCCATACTGG + Intergenic
929933806 2:46278553-46278575 GACCAGACCTTGCCTCATATTGG + Intergenic
931160461 2:59684540-59684562 GGCCAGTCTTTGGCCCACACAGG - Intergenic
932010413 2:67972052-67972074 CACCAGCCCCTGGCCCACATGGG - Intergenic
936683162 2:114798186-114798208 CCCCACCCCTTGGCCCATCCTGG - Intronic
937771010 2:125721042-125721064 CACCAGCCCTTTGCCCTTGCTGG + Intergenic
938656863 2:133443370-133443392 GACCAGCCAGTGGCCATTACTGG - Intronic
943395311 2:187326136-187326158 GAACATCCCTTAGCCCAGACAGG + Intergenic
949031372 2:241798967-241798989 GTCCAGGCCTTGGGCCACACAGG - Intronic
1168877315 20:1180669-1180691 GCCCAGCCCATGCCCCACACGGG - Exonic
1171171201 20:23017035-23017057 GACCAACCCTTGAGCCACACAGG - Intergenic
1172150990 20:32790231-32790253 GACAAGTCCTGGGCCCATGCTGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1175996114 20:62813041-62813063 GCCCAGACCTTGGCCCTTGCCGG + Exonic
1176025094 20:62981716-62981738 CACCGGGCCTTTGCCCATACTGG - Intergenic
1176430307 21:6571339-6571361 GCCCAGCACTTGGCCATTACCGG - Intergenic
1177120168 21:17128268-17128290 GATCAGCCCGTGGACAATACCGG + Intergenic
1179705701 21:43178801-43178823 GCCCAGCACTTGGCCATTACCGG - Intergenic
1181943713 22:26498899-26498921 GACCAGCTCTTGTCCCATGGCGG - Exonic
1183437344 22:37803662-37803684 AAACAGCTCTTGGACCATACCGG + Intergenic
1183537866 22:38413579-38413601 GACCAGACCTTGGCTTAGACGGG + Intergenic
1183947284 22:41333716-41333738 GCTCAGTGCTTGGCCCATACTGG - Intronic
1184176590 22:42792666-42792688 CACTAGCCCTTGGCCCAGCCAGG - Intergenic
1185419870 22:50729267-50729289 CACCAGTCCCTGCCCCATACAGG - Intergenic
950169110 3:10824269-10824291 GTCCAGCCTTTGACCCATACAGG - Intronic
950248919 3:11447811-11447833 GACCTGCCCCTGGCCCAGGCTGG - Intronic
952333232 3:32383843-32383865 ACCCAGCCCTTTGCCCACACTGG - Intergenic
954442198 3:50527936-50527958 GCCCAGCCCAGGGGCCATACTGG + Intergenic
955043202 3:55336356-55336378 TCCCAGCCCTTGGCCCATGGGGG - Intergenic
960599357 3:119440294-119440316 GACCTGCCCTATCCCCATACTGG + Intronic
961532876 3:127550465-127550487 GACCACCCCATGCCCCAGACAGG - Intergenic
967770189 3:193325947-193325969 GGCCAGCCCTTTGCCCAGACAGG - Intronic
969704669 4:8785288-8785310 GCCCAGCCCCTGGCCCCCACCGG + Intergenic
973022426 4:45220247-45220269 CACCAGCCCTTTGCCCTCACTGG - Intergenic
973760263 4:54109081-54109103 GACCAGGCCTTTGCCCACGCGGG - Intronic
982046671 4:151454336-151454358 GAACAGTCTTTGGCCCAAACAGG - Intronic
982963769 4:161875779-161875801 CACCAGGCTTTGGCCAATACTGG + Intronic
998156300 5:139788777-139788799 CACCAGCCCTGGCCCCATGCTGG + Intergenic
1001008664 5:168077358-168077380 GAACAGTGCTTGGCCCATAGTGG - Intronic
1005026449 6:21467084-21467106 CACCAGCCCTTTGCCCTCACTGG + Intergenic
1005668474 6:28081068-28081090 GACCAGACCTTGGCCCTCAGAGG + Exonic
1015384351 6:132605145-132605167 GACCAGCCCCATGCCCAGACTGG + Intergenic
1015447649 6:133326188-133326210 GACCAGAGCTTGACCCATGCTGG + Intronic
1019557922 7:1641786-1641808 GACCATCCCCTGGCCCCTCCGGG - Intergenic
1021203537 7:17753038-17753060 GAACAGCCCTTGGGCCTTACCGG - Intergenic
1023980845 7:45069047-45069069 GCCCAGCCCTTGGCTCTTCCAGG - Intronic
1024363546 7:48494590-48494612 GATCAGTCCTTGTTCCATACTGG - Intronic
1029970047 7:104780068-104780090 CACCAGCCCTTGGCCCCCAGTGG + Intronic
1033212500 7:139470397-139470419 GGCCAGACCATGGCTCATACTGG - Intronic
1034162863 7:149005602-149005624 GACCAGCCCTGGCCCCAGGCAGG - Intronic
1034178347 7:149118137-149118159 AACCAGCCCACGGCTCATACAGG + Intronic
1049054743 8:140227105-140227127 GCTGAGCCCTTCGCCCATACAGG + Intronic
1050138754 9:2495797-2495819 GACCAGCCCAGGGCCCTTGCAGG + Intergenic
1057856070 9:98601744-98601766 GACCAGCCCTTGGCCCATACTGG - Intronic
1058765989 9:108183208-108183230 CACCAGGCCTTGGCTCACACGGG + Intergenic
1060934290 9:127506581-127506603 GTCCAGCCCTTGGCACAAGCAGG + Exonic
1061046547 9:128168141-128168163 GACCAGGCCTTGGCCCTCATGGG + Intronic
1196828038 X:119756429-119756451 GACCAGGCCTAGGCCCAGAATGG - Intergenic
1200428249 Y:3046073-3046095 GACCTGCCCTAGCCCCATCCAGG - Intergenic