ID: 1057857049

View in Genome Browser
Species Human (GRCh38)
Location 9:98609842-98609864
Sequence CAGGCTCAGGGCCAGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057857036_1057857049 27 Left 1057857036 9:98609792-98609814 CCCCGTCTGCTACCCTACTCAGT 0: 1
1: 0
2: 1
3: 9
4: 71
Right 1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG No data
1057857038_1057857049 25 Left 1057857038 9:98609794-98609816 CCGTCTGCTACCCTACTCAGTTT 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG No data
1057857037_1057857049 26 Left 1057857037 9:98609793-98609815 CCCGTCTGCTACCCTACTCAGTT 0: 1
1: 0
2: 1
3: 9
4: 85
Right 1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG No data
1057857040_1057857049 15 Left 1057857040 9:98609804-98609826 CCCTACTCAGTTTGTGTGGACGC 0: 1
1: 0
2: 1
3: 3
4: 42
Right 1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG No data
1057857041_1057857049 14 Left 1057857041 9:98609805-98609827 CCTACTCAGTTTGTGTGGACGCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057857049 Original CRISPR CAGGCTCAGGGCCAGGACAC TGG Intronic
No off target data available for this crispr