ID: 1057858000

View in Genome Browser
Species Human (GRCh38)
Location 9:98617048-98617070
Sequence TTATACCTTCAGAATGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057858000_1057858002 0 Left 1057858000 9:98617048-98617070 CCATTCACATTCTGAAGGTATAA 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1057858002 9:98617071-98617093 ATGAGACCTAGAATTTTCCTGGG No data
1057858000_1057858001 -1 Left 1057858000 9:98617048-98617070 CCATTCACATTCTGAAGGTATAA 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1057858001 9:98617070-98617092 AATGAGACCTAGAATTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057858000 Original CRISPR TTATACCTTCAGAATGTGAA TGG (reversed) Intronic
903314536 1:22491388-22491410 TTCTACATTTAGGATGTGAAAGG + Exonic
903725777 1:25443131-25443153 TATGACCTTCAGAATATGAAAGG + Intronic
905622333 1:39459126-39459148 TTTTTGCTTCAGACTGTGAAAGG - Exonic
906891628 1:49722234-49722256 TTATATCTTCAGAAAAAGAAAGG - Intronic
909919231 1:81359810-81359832 TTTTGGCTTCAGAAAGTGAATGG - Intronic
910179946 1:84471728-84471750 TTATATCTTTGGAATGTGTATGG - Intergenic
910648896 1:89543215-89543237 ATATACATTAAAAATGTGAAGGG - Intronic
911482609 1:98462725-98462747 TTATACCTTAATTCTGTGAATGG + Intergenic
916008785 1:160685733-160685755 GCAAACCTTCAGAAGGTGAAGGG - Intronic
916088836 1:161291167-161291189 TGCTACCTACAGAATATGAATGG + Intergenic
916308322 1:163364925-163364947 GTAAATCTTCAGAATGTCAAAGG + Intergenic
916391439 1:164335155-164335177 TTCTACCTTTAGAATGTTCAAGG + Intergenic
917104509 1:171478760-171478782 TTTGACCTTCATAATGTGAGTGG + Intergenic
917240973 1:172948502-172948524 TATTACCTTCCAAATGTGAATGG - Intergenic
920256556 1:204659209-204659231 GTATCCCTTGAGAATGTCAAGGG + Intronic
920455413 1:206097439-206097461 TTATAGATTCAGCATGTGAAAGG - Intronic
921598027 1:217076087-217076109 TTATACCATCTGTATGTGGAAGG + Intronic
921961921 1:221044667-221044689 TTATCCCTTCAGTATTGGAAAGG + Intergenic
923803739 1:237235993-237236015 ATATTCCTTCAGAATATGACAGG - Intronic
1063147649 10:3310535-3310557 TTATACCTCCAGAATGGAATAGG + Intergenic
1064741202 10:18436669-18436691 TTATACCTACAAAATGTTACTGG + Intronic
1065683402 10:28260371-28260393 TTATACCTACAGACTATAAATGG + Intronic
1067737933 10:48873344-48873366 CTACACCCTCAGAATGTGTAGGG - Intronic
1068877587 10:62013271-62013293 TCAGACCTTCAGAATTTGAATGG + Intronic
1069194259 10:65528733-65528755 TTATAACTTCAGAATGTACTTGG + Intergenic
1070365304 10:75731002-75731024 TGATAACGTCAAAATGTGAAGGG + Intronic
1070369973 10:75772942-75772964 GTACACCTTCTGAAAGTGAATGG + Intronic
1070479439 10:76867852-76867874 TTATACTCTCTGAATGTGAGAGG + Intergenic
1071176400 10:82931410-82931432 TTATATACTCAGAAGGTGAAAGG - Intronic
1071942401 10:90604609-90604631 TCATGCCTTCATAATATGAAAGG - Intergenic
1074737896 10:116454739-116454761 TTATACCTGCACAATGAAAAAGG - Intronic
1075097848 10:119484414-119484436 TTAGGTCTTCAGAATGTAAAGGG - Intergenic
1078690707 11:13577886-13577908 TTATATCTTTAGAGTATGAAAGG - Intergenic
1079386894 11:19988573-19988595 TAAAACATTCAGAATTTGAAGGG - Intronic
1081156596 11:39700579-39700601 TTAGACCTACATAATGTCAAAGG - Intergenic
1083082856 11:60111700-60111722 TTATATCTTCAGACTGGGATGGG + Intergenic
1085670066 11:78454991-78455013 TTATTCCTTCAGAATGTTTTAGG + Intronic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1087968647 11:104451840-104451862 TTATAGTTCAAGAATGTGAATGG + Intergenic
1088170493 11:106990805-106990827 ATAGACTTTCAGAATGTGAAAGG - Intronic
1090022026 11:123136869-123136891 TTATACTTTCAGAAAATCAAAGG - Intronic
1090582327 11:128173756-128173778 ATATAACCTCAGAATCTGAATGG + Intergenic
1091100153 11:132864330-132864352 GCAAACCTTCAGAAGGTGAAGGG + Intronic
1091136208 11:133192496-133192518 TTTTACCTTCAGAAAGGGAGTGG - Intronic
1091661941 12:2390793-2390815 TGATGCCTCCAGAAGGTGAATGG - Intronic
1092619900 12:10252528-10252550 TTATAACTTGAGAATGTGGTGGG - Intergenic
1098517667 12:71396179-71396201 TTATAGCTTGAGCATTTGAAAGG - Intronic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098901215 12:76113771-76113793 TTTTCCCTTCAGATTCTGAATGG + Intergenic
1107068371 13:36242579-36242601 TTATAGTTTCAGAGAGTGAACGG + Intronic
1108110111 13:47062038-47062060 TTATAACTTCAGGATGTTAAAGG - Intergenic
1109765595 13:66891922-66891944 TTCTAGCTACAGAAGGTGAAGGG - Intronic
1110700183 13:78537904-78537926 GTATACTTACAGAATGTGAAGGG + Intergenic
1111153966 13:84297554-84297576 TCATACCTTAAGAATGAAAAAGG - Intergenic
1111644974 13:91021468-91021490 TAATACCATCCAAATGTGAAAGG + Intergenic
1111943660 13:94640358-94640380 TAATACCTTCTAATTGTGAAAGG - Intergenic
1112956550 13:105066170-105066192 TGATACAATCAGGATGTGAATGG + Intergenic
1121221735 14:92290530-92290552 TTGAAACTTCAGAGTGTGAAAGG + Intergenic
1121497521 14:94404684-94404706 TGATACCTACAGAATGAAAACGG + Intergenic
1121514534 14:94540624-94540646 TTTTACCCACAGAATGTGATAGG - Intergenic
1123175358 14:106411477-106411499 TTATACCTGCCTACTGTGAAAGG - Intergenic
1123186738 14:106525177-106525199 TTATACCCTCCTACTGTGAAGGG - Intergenic
1123554033 15:21408196-21408218 TGCTACCCTCAGAATGTCAAGGG - Intergenic
1124827394 15:33112210-33112232 TTATACCTTTATAATTTTAAGGG - Intronic
1124920742 15:34023794-34023816 ATACACCTTCAGGCTGTGAAGGG + Intronic
1127177193 15:56372276-56372298 TTAAAGCTTCAGACTGTTAAAGG + Intronic
1127406153 15:58648737-58648759 TTATAACTTCAGAATATGTAAGG - Intronic
1127833998 15:62775284-62775306 TTATTCGTACAGAAGGTGAAAGG - Intronic
1127891082 15:63251651-63251673 CTCTACCTTCAAAATGTGGAAGG - Intronic
1131306497 15:91248542-91248564 TAATACCCTCAGAAAGTGAGAGG + Intronic
1132279987 15:100603879-100603901 GTGTACCTTAAGAGTGTGAATGG + Intronic
1133153062 16:3851378-3851400 TTCTGTCTTCAGAATTTGAAGGG - Intronic
1137319636 16:47367437-47367459 AAATAACTTCAGAATGTGACTGG - Intronic
1137934066 16:52617076-52617098 TGAGACCTTGAGAATCTGAAGGG + Intergenic
1139763528 16:69207077-69207099 TTATTCTTTCAAAATATGAAAGG + Intronic
1140689822 16:77471051-77471073 TAATACCTTTAGAATGTGCCTGG + Intergenic
1144063599 17:11604748-11604770 CTATACCTTCAAAATTTGTATGG + Intronic
1147342881 17:39765335-39765357 TTAACCCTTCAGCCTGTGAAGGG + Exonic
1147680041 17:42237141-42237163 TTATGCCTTCAGAAAGTACAGGG - Intronic
1149058373 17:52391453-52391475 TTCTACCTGCAGCATCTGAATGG + Intergenic
1150887762 17:69107424-69107446 AGATACCTTCAGGCTGTGAAAGG - Intronic
1151068872 17:71185368-71185390 TGCTACCTTCATAATATGAATGG + Intergenic
1155733572 18:29192784-29192806 GTGAACCTTCAGAAAGTGAAAGG + Intergenic
1155838615 18:30619657-30619679 TTAAACCTACTGAATGTGAAAGG - Intergenic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1158617120 18:58998211-58998233 TCATGCATTCAAAATGTGAATGG - Intergenic
1159246927 18:65818404-65818426 TTATCCAGTCAGAATGTGCATGG + Intronic
1159657928 18:71055207-71055229 ATCCACCTTCAGAAAGTGAATGG + Intergenic
1159982162 18:74796275-74796297 TTATATCTTCAGTATATTAATGG + Intronic
1162489710 19:10984922-10984944 TTATACATACAGCATCTGAAAGG + Intronic
1167391033 19:49195122-49195144 GTATACCTTAAGTAAGTGAACGG - Intronic
1202636362 1_KI270706v1_random:47798-47820 TTCTACCCTCAGAATATCAAGGG - Intergenic
925480618 2:4267482-4267504 TTATGCTTTCAAAATCTGAAAGG + Intergenic
926565570 2:14467377-14467399 TTATACAATCAAAATGTGTAAGG + Intergenic
928498025 2:31854809-31854831 TTATACATACAGTATGTGAGGGG - Intergenic
930482871 2:51971460-51971482 TTATGCCTTGAGAATATGATTGG - Intergenic
931928478 2:67101293-67101315 TTATACATTGAGAATGTGTGTGG - Intergenic
933347653 2:81109719-81109741 TTATAGCATCAGAATGTATAAGG - Intergenic
933865100 2:86508946-86508968 TTCTACCTCCAGAGTGTGAAGGG - Intronic
935607849 2:104988493-104988515 TTATATATTCACCATGTGAATGG - Intergenic
935676599 2:105599718-105599740 TTATCCCTTCATCATGGGAATGG + Intergenic
935804880 2:106735428-106735450 TTATTCCCTCAGAGTGAGAACGG + Intergenic
936634635 2:114241748-114241770 TTATGCCTTGAAAAAGTGAAAGG - Intergenic
936918834 2:117667038-117667060 TTAGACCATCATTATGTGAAGGG + Intergenic
939231267 2:139429101-139429123 TTAGACTTTCAGATTTTGAAAGG - Intergenic
940377044 2:152968776-152968798 TTTTACCTTCAGAAGAGGAAGGG + Intergenic
941569307 2:167149697-167149719 TTATGACTTCAGAATAAGAAAGG + Intronic
944275147 2:197828593-197828615 TTATACCTTTGCAATGTCAAAGG + Intronic
946541035 2:220684868-220684890 TTAAACCTTCAGAATGATGATGG - Intergenic
1171942030 20:31339669-31339691 TTAGACCTTCAGAGAGTGACAGG - Intergenic
1172399461 20:34637177-34637199 TTAGAACTTCAGAATTAGAAGGG - Intronic
1172675482 20:36667907-36667929 TAATACCTTTAGAATGAGACTGG - Intronic
1173896510 20:46555099-46555121 ATCACCCTTCAGAATGTGAATGG + Intergenic
1174934787 20:54855495-54855517 TTGAACCTTCAGTATGTGATGGG + Intergenic
1175427939 20:58881730-58881752 TCATACCTTCCATATGTGAAGGG + Intronic
1177384901 21:20396244-20396266 TTATCCCTTGGGAAAGTGAATGG - Intergenic
1177939801 21:27395447-27395469 TTATATCTTCAAAATATGCATGG + Intergenic
1178965001 21:37108551-37108573 GTAGAGCTCCAGAATGTGAAAGG + Intronic
1180364503 22:11926518-11926540 TTCTACCCTCAGAATATCAAGGG + Intergenic
949809384 3:7989876-7989898 ATATACCTCCACATTGTGAATGG + Intergenic
952059055 3:29484644-29484666 TTAAAACTTCAGAATATAAATGG + Intronic
952374630 3:32755823-32755845 TAGTTCCTTCAGCATGTGAAGGG + Intronic
955422433 3:58751998-58752020 TTATATCATCAGAAGGGGAAGGG - Intronic
957012260 3:75020599-75020621 TTGTAACTTCAGTATTTGAAAGG + Intergenic
957131431 3:76227140-76227162 ATATACTTTCAGAAAGAGAAAGG - Intronic
957228416 3:77478880-77478902 TTAAACCTTTAGAGGGTGAAGGG - Intronic
958094812 3:88930034-88930056 TTATACATTTACAATTTGAAAGG + Intergenic
958791574 3:98657332-98657354 TTTTACCTGCAGAATATCAAGGG - Intergenic
958820247 3:98965295-98965317 TTATAGCTCCAGGTTGTGAATGG - Intergenic
958989369 3:100824572-100824594 TTCTACCTTTAAGATGTGAATGG + Intronic
959953385 3:112207255-112207277 CTATCCCTTCAGAATTTCAATGG - Intronic
960107323 3:113812290-113812312 TTTTACTTTGAGAAAGTGAATGG + Intergenic
960438402 3:117656065-117656087 AAATATCTTCAGAATGTAAAAGG + Intergenic
963280390 3:143378883-143378905 CAATACCTTTAGAATGTGAATGG - Intronic
963392291 3:144680856-144680878 TTAAAGCTTCAACATGTGAATGG + Intergenic
964349024 3:155784372-155784394 TTATAACTTTAGGATGTTAATGG + Intronic
965460615 3:168957545-168957567 TTAGTCTTTCACAATGTGAAGGG - Intergenic
967770292 3:193326817-193326839 TTCTAATTTCAGAATGAGAAAGG - Intronic
969959247 4:10926664-10926686 ATACAGCTTCAGAATTTGAAGGG + Intergenic
971515052 4:27475071-27475093 TTAAACTTTCAGAAGGGGAAGGG - Intergenic
971581457 4:28346588-28346610 TTACAACTTCAGAATGGGTATGG + Intergenic
971662138 4:29432564-29432586 TTTCATCTTCACAATGTGAATGG - Intergenic
972816820 4:42654999-42655021 TTATAGCTTCAGCATGTGCTTGG - Intronic
974362851 4:60904888-60904910 TAATATCTTCACATTGTGAAAGG + Intergenic
979559459 4:122085687-122085709 TTATTCCTTAGGAATGTTAATGG - Intergenic
979803749 4:124944756-124944778 TTATAAATTCAGAATCAGAAAGG - Intergenic
979834690 4:125350070-125350092 TTATTCATTCATTATGTGAAAGG - Intronic
979913331 4:126398233-126398255 CTGTAACTTCAGAAAGTGAAAGG - Intergenic
980240693 4:130170786-130170808 TAAGACCTTTAGAATGTGGAGGG - Intergenic
980691929 4:136306347-136306369 TTTTAGCTTGAGAATGTAAAAGG - Intergenic
981389790 4:144175377-144175399 TGAAACCTTGAAAATGTGAAAGG - Intergenic
982774589 4:159428642-159428664 TTATACTTTTAAAATGTTAAAGG + Intergenic
982792374 4:159607899-159607921 TAATTAATTCAGAATGTGAAAGG + Intergenic
984845301 4:184103248-184103270 TTATACTTTCAGTAGTTGAAAGG - Intronic
986030267 5:3886765-3886787 TTATACATTCAGACGGTGACAGG - Intergenic
990521551 5:56586302-56586324 CTCTACGTTCAGGATGTGAACGG - Intronic
990597328 5:57324697-57324719 TTCTACCTTCAGGATTTTAATGG + Intergenic
993595852 5:89854179-89854201 ACATTCCTTCAGAATGTGGAAGG - Intergenic
994748630 5:103710728-103710750 TAATGCCTTCAAAATGTGAAAGG - Intergenic
995084929 5:108097498-108097520 TTATACCTTCAGGCTGGGAGTGG + Intronic
995170357 5:109103940-109103962 TGATATCTTCAGAAAGTAAAAGG + Intronic
995234677 5:109814174-109814196 TTATATCTTCAGAATGGGGAGGG - Intronic
995798747 5:115968725-115968747 TTATACCGTCAGAAGGAGGAGGG - Intronic
996026527 5:118652625-118652647 TTATAGATTCTGAGTGTGAAAGG + Intergenic
998721063 5:144949820-144949842 TTATAATTTAAGTATGTGAAAGG + Intergenic
998870206 5:146544236-146544258 TTCTACCTTCAAAATCTCAAGGG - Intergenic
999075579 5:148792499-148792521 TTATAGCTTCACCATGTAAATGG - Intergenic
999727353 5:154447202-154447224 TTATTCCTTCAGACAGAGAAAGG + Intronic
1000943948 5:167397534-167397556 TTATCTCTTCAAAATGAGAAGGG - Intronic
1001911943 5:175527367-175527389 ATATACATTCAGATTGTGAGTGG + Exonic
1003575330 6:7288201-7288223 ATATTCCTTGGGAATGTGAAGGG + Exonic
1005609555 6:27510553-27510575 TAATACCTTCAGCATGGGCAGGG - Intergenic
1009381146 6:63031786-63031808 TAATATCTTCAAAATCTGAAGGG - Intergenic
1009855597 6:69258824-69258846 TTATACCTTCAGGAGTTGAACGG + Intronic
1011824032 6:91285659-91285681 TTATATCCTCAGTTTGTGAAAGG - Intergenic
1011857129 6:91707700-91707722 CTATATCTTCTGAATTTGAAAGG + Intergenic
1012882677 6:104809813-104809835 TTCTACCTTCAGAATATGTTCGG - Intronic
1012937609 6:105384399-105384421 TTATACCTTCAGAAAGTTTGAGG + Intronic
1015002394 6:128234102-128234124 TTATAACTTGAGGATATGAAAGG - Intronic
1016831515 6:148438403-148438425 TTATATATTCCAAATGTGAATGG - Intronic
1017055036 6:150429252-150429274 GTTGACTTTCAGAATGTGAAAGG - Intergenic
1017789839 6:157787799-157787821 TTATAGCTTAAGAATATGTAAGG - Intronic
1018637262 6:165873475-165873497 TTATAAATTCAGAGTTTGAAAGG + Intronic
1019843084 7:3468894-3468916 GCATACCTTCAGAGGGTGAAGGG + Intronic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021199008 7:17706406-17706428 TTATTGCTACAGAATGTGACAGG - Intergenic
1022987551 7:35673150-35673172 AGATACATTCAGAATGTGAGAGG - Intronic
1028906743 7:96163009-96163031 TGAAACCTTCACAAGGTGAAGGG + Intronic
1028935459 7:96459069-96459091 TTAAACATCTAGAATGTGAAGGG + Intergenic
1031027890 7:116700459-116700481 TTATATCTTTAAAATGTAAATGG + Intronic
1031130370 7:117826568-117826590 TTAGAACTTCAGTAAGTGAATGG - Intronic
1032211998 7:129924079-129924101 TTATACCTTCAGGATGGGCATGG + Intronic
1033393152 7:140948463-140948485 TTATATATTTGGAATGTGAATGG - Intergenic
1033967295 7:146991824-146991846 TTAGAACTTAACAATGTGAATGG + Intronic
1036474084 8:9077341-9077363 TTGAACCTTCAGAAGGTAAAAGG - Intronic
1036514550 8:9431580-9431602 CTATACTTTCAGAATGGGAGGGG + Intergenic
1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG + Intergenic
1037513685 8:19609282-19609304 TTATGCATACAGAATGTAAATGG + Intronic
1037894703 8:22644190-22644212 TTTTATCTCCAGAATGGGAAAGG - Intronic
1038051303 8:23815510-23815532 TTATAACTTTAGGATGTTAAAGG + Intergenic
1038900460 8:31837318-31837340 TTATACTCTCAGAATGAGGAAGG - Intronic
1040925053 8:52672108-52672130 TTATACCTTCAGAAAATAGAAGG - Intronic
1041585718 8:59515587-59515609 TTATAATCTCAGAATGAGAAAGG - Intergenic
1042978232 8:74494900-74494922 CTAAATCTTCAGAATGTTAAAGG - Intergenic
1042984669 8:74569737-74569759 ATATACATTTAGATTGTGAAAGG + Intergenic
1043743572 8:83844592-83844614 TCTGAACTTCAGAATGTGAAGGG - Intergenic
1043934452 8:86127748-86127770 TTATACATACAGAATGTACAAGG - Intronic
1044745454 8:95366467-95366489 TTAAAGCTTCAGCATATGAATGG + Intergenic
1044748378 8:95393361-95393383 TTATACCTTCAGAATATGCAGGG + Intergenic
1046332758 8:112742282-112742304 TTATATCTTAAGACTGTGATAGG - Intronic
1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG + Exonic
1050343859 9:4666693-4666715 TTCTACTTTCAGAATGAAAACGG - Intergenic
1051182926 9:14429819-14429841 TTATTACATCAGAATCTGAATGG - Intergenic
1052148345 9:25078476-25078498 TTTTACTTTCAGAATATCAAAGG - Intergenic
1053405909 9:37875710-37875732 ATATACCTTGAGAAGGTTAAAGG - Intronic
1057079182 9:92159545-92159567 GAATACTTTAAGAATGTGAATGG - Intergenic
1057858000 9:98617048-98617070 TTATACCTTCAGAATGTGAATGG - Intronic
1059148535 9:111925332-111925354 TTATAATTTCAGTATATGAAAGG - Intronic
1059295965 9:113271056-113271078 TTCTACCTTCAGAATATGTCTGG - Intronic
1061322730 9:129841430-129841452 TTAGAACTTCAGCATATGAATGG + Intronic
1186124394 X:6397325-6397347 TTATTCCTATAGAATGTTAATGG - Intergenic
1186209969 X:7240260-7240282 TTATACCTCCAAAATGTGCCTGG - Intronic
1186547270 X:10463531-10463553 TTACACAATCAGTATGTGAAAGG - Intronic
1187029289 X:15469146-15469168 TTTTAAATTCAGATTGTGAAAGG + Intronic
1188291824 X:28398998-28399020 TTATAATTTCATAATGTGGATGG + Intergenic
1189120981 X:38394750-38394772 TTATATCTTCAGATTATTAAAGG - Intronic
1190952850 X:55162861-55162883 TTGTTCCTTGAGAATGTGGAAGG - Intronic
1194710560 X:97231597-97231619 TAATATTTTCAAAATGTGAATGG - Intronic
1194742537 X:97591358-97591380 TTCTACCCTCATAATGTGCAAGG + Intronic
1195433480 X:104815509-104815531 TTATATCTTCAGAAGGTCATTGG - Intronic
1195881588 X:109598260-109598282 TTATAACCTCAGAATGGGTATGG + Intergenic
1200667609 Y:6046453-6046475 TTATACCTACTGAAATTGAAAGG - Intergenic