ID: 1057858654

View in Genome Browser
Species Human (GRCh38)
Location 9:98622711-98622733
Sequence CATCAAAGAGTACCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057858654_1057858659 11 Left 1057858654 9:98622711-98622733 CCCTGGGGTGGTACTCTTTGATG No data
Right 1057858659 9:98622745-98622767 TCTTTTCACAGTGGTGAGGCAGG No data
1057858654_1057858656 2 Left 1057858654 9:98622711-98622733 CCCTGGGGTGGTACTCTTTGATG No data
Right 1057858656 9:98622736-98622758 ACCTCTTTTTCTTTTCACAGTGG No data
1057858654_1057858658 7 Left 1057858654 9:98622711-98622733 CCCTGGGGTGGTACTCTTTGATG No data
Right 1057858658 9:98622741-98622763 TTTTTCTTTTCACAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057858654 Original CRISPR CATCAAAGAGTACCACCCCA GGG (reversed) Intronic