ID: 1057859755

View in Genome Browser
Species Human (GRCh38)
Location 9:98631026-98631048
Sequence TCTACTGCATAGCGCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057859749_1057859755 25 Left 1057859749 9:98630978-98631000 CCATTTGAGACAGCACAGATAGA 0: 1
1: 0
2: 2
3: 43
4: 289
Right 1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG No data
1057859752_1057859755 -6 Left 1057859752 9:98631009-98631031 CCATTATCACAGGAATTTCTACT 0: 1
1: 0
2: 11
3: 81
4: 402
Right 1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057859755 Original CRISPR TCTACTGCATAGCGCTGCTG GGG Intronic
No off target data available for this crispr