ID: 1057859831

View in Genome Browser
Species Human (GRCh38)
Location 9:98632187-98632209
Sequence ATGTCCTAGTGGAAGGGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057859826_1057859831 -2 Left 1057859826 9:98632166-98632188 CCCTTCACAAATGAAAGAAGTAT 0: 1
1: 2
2: 2
3: 39
4: 446
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data
1057859825_1057859831 4 Left 1057859825 9:98632160-98632182 CCAGGACCCTTCACAAATGAAAG 0: 1
1: 1
2: 8
3: 54
4: 394
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data
1057859823_1057859831 6 Left 1057859823 9:98632158-98632180 CCCCAGGACCCTTCACAAATGAA 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data
1057859822_1057859831 15 Left 1057859822 9:98632149-98632171 CCTTGTCTTCCCCAGGACCCTTC 0: 1
1: 0
2: 6
3: 39
4: 401
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data
1057859827_1057859831 -3 Left 1057859827 9:98632167-98632189 CCTTCACAAATGAAAGAAGTATG 0: 1
1: 0
2: 2
3: 29
4: 378
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data
1057859824_1057859831 5 Left 1057859824 9:98632159-98632181 CCCAGGACCCTTCACAAATGAAA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057859831 Original CRISPR ATGTCCTAGTGGAAGGGTCA CGG Intronic
No off target data available for this crispr