ID: 1057863006

View in Genome Browser
Species Human (GRCh38)
Location 9:98656924-98656946
Sequence GGCCCTAGATGCTGGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057863006 Original CRISPR GGCCCTAGATGCTGGATCAG AGG Intronic