ID: 1057869922

View in Genome Browser
Species Human (GRCh38)
Location 9:98709401-98709423
Sequence CCGCGCGCTGGCACACGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057869916_1057869922 4 Left 1057869916 9:98709374-98709396 CCGGGGACAGCGATCTGGGAACC 0: 1
1: 0
2: 2
3: 13
4: 96
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data
1057869911_1057869922 20 Left 1057869911 9:98709358-98709380 CCAGGCACCAGAGCGCCCGGGGA 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data
1057869915_1057869922 5 Left 1057869915 9:98709373-98709395 CCCGGGGACAGCGATCTGGGAAC 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data
1057869912_1057869922 13 Left 1057869912 9:98709365-98709387 CCAGAGCGCCCGGGGACAGCGAT 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data
1057869907_1057869922 23 Left 1057869907 9:98709355-98709377 CCTCCAGGCACCAGAGCGCCCGG 0: 1
1: 1
2: 1
3: 22
4: 175
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data
1057869906_1057869922 30 Left 1057869906 9:98709348-98709370 CCGCTGACCTCCAGGCACCAGAG 0: 1
1: 0
2: 5
3: 114
4: 1088
Right 1057869922 9:98709401-98709423 CCGCGCGCTGGCACACGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057869922 Original CRISPR CCGCGCGCTGGCACACGCAG TGG Intergenic
No off target data available for this crispr