ID: 1057872026

View in Genome Browser
Species Human (GRCh38)
Location 9:98725525-98725547
Sequence CAATATGTCCTCAGATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872026_1057872031 4 Left 1057872026 9:98725525-98725547 CCTGGGTATCTGAGGACATATTG No data
Right 1057872031 9:98725552-98725574 GACTTGGAGTAAATACAGCATGG No data
1057872026_1057872032 8 Left 1057872026 9:98725525-98725547 CCTGGGTATCTGAGGACATATTG No data
Right 1057872032 9:98725556-98725578 TGGAGTAAATACAGCATGGAAGG No data
1057872026_1057872034 21 Left 1057872026 9:98725525-98725547 CCTGGGTATCTGAGGACATATTG No data
Right 1057872034 9:98725569-98725591 GCATGGAAGGACAGGTGCACTGG No data
1057872026_1057872033 13 Left 1057872026 9:98725525-98725547 CCTGGGTATCTGAGGACATATTG No data
Right 1057872033 9:98725561-98725583 TAAATACAGCATGGAAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872026 Original CRISPR CAATATGTCCTCAGATACCC AGG (reversed) Intergenic
No off target data available for this crispr