ID: 1057872032

View in Genome Browser
Species Human (GRCh38)
Location 9:98725556-98725578
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872026_1057872032 8 Left 1057872026 9:98725525-98725547 CCTGGGTATCTGAGGACATATTG No data
Right 1057872032 9:98725556-98725578 TGGAGTAAATACAGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872032 Original CRISPR TGGAGTAAATACAGCATGGA AGG Intergenic
No off target data available for this crispr