ID: 1057872824

View in Genome Browser
Species Human (GRCh38)
Location 9:98731105-98731127
Sequence CTGTGTGACCTCAACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872819_1057872824 25 Left 1057872819 9:98731057-98731079 CCAGGAAGAGTGTGAGGCCTGCA No data
Right 1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG No data
1057872820_1057872824 8 Left 1057872820 9:98731074-98731096 CCTGCACTCAGACCAGACTGTCC No data
Right 1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG No data
1057872821_1057872824 -4 Left 1057872821 9:98731086-98731108 CCAGACTGTCCCTTGTCAGCTGT No data
Right 1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872824 Original CRISPR CTGTGTGACCTCAACAAAGT TGG Intergenic
No off target data available for this crispr