ID: 1057872882

View in Genome Browser
Species Human (GRCh38)
Location 9:98731556-98731578
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872882_1057872889 9 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872889 9:98731588-98731610 GCCTTGGAGAGGGCTCCAGCAGG 0: 1
1: 0
2: 1
3: 30
4: 193
1057872882_1057872884 -7 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872884 9:98731572-98731594 CATGCCCTGTGTCTCAGCCTTGG 0: 1
1: 0
2: 1
3: 37
4: 360
1057872882_1057872891 15 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872891 9:98731594-98731616 GAGAGGGCTCCAGCAGGAAATGG 0: 1
1: 0
2: 2
3: 49
4: 390
1057872882_1057872888 -1 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872888 9:98731578-98731600 CTGTGTCTCAGCCTTGGAGAGGG 0: 1
1: 0
2: 6
3: 24
4: 406
1057872882_1057872893 23 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872882_1057872896 27 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872896 9:98731606-98731628 GCAGGAAATGGGAACCTGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 357
1057872882_1057872892 16 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872892 9:98731595-98731617 AGAGGGCTCCAGCAGGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 233
1057872882_1057872895 24 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872895 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 265
1057872882_1057872887 -2 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872887 9:98731577-98731599 CCTGTGTCTCAGCCTTGGAGAGG 0: 1
1: 0
2: 2
3: 39
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872882 Original CRISPR GGGCATGGCCATCCTTGTGT CGG (reversed) Intronic