ID: 1057872883

View in Genome Browser
Species Human (GRCh38)
Location 9:98731571-98731593
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 581}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872883_1057872896 12 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872896 9:98731606-98731628 GCAGGAAATGGGAACCTGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 357
1057872883_1057872893 8 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872883_1057872891 0 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872891 9:98731594-98731616 GAGAGGGCTCCAGCAGGAAATGG 0: 1
1: 0
2: 2
3: 49
4: 390
1057872883_1057872892 1 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872892 9:98731595-98731617 AGAGGGCTCCAGCAGGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 233
1057872883_1057872895 9 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872895 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 265
1057872883_1057872889 -6 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872889 9:98731588-98731610 GCCTTGGAGAGGGCTCCAGCAGG 0: 1
1: 0
2: 1
3: 30
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872883 Original CRISPR CAAGGCTGAGACACAGGGCA TGG (reversed) Intronic