ID: 1057872885

View in Genome Browser
Species Human (GRCh38)
Location 9:98731576-98731598
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 408}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872885_1057872891 -5 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872891 9:98731594-98731616 GAGAGGGCTCCAGCAGGAAATGG 0: 1
1: 0
2: 2
3: 49
4: 390
1057872885_1057872893 3 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872885_1057872892 -4 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872892 9:98731595-98731617 AGAGGGCTCCAGCAGGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 233
1057872885_1057872898 29 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872885_1057872895 4 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872895 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 265
1057872885_1057872896 7 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872896 9:98731606-98731628 GCAGGAAATGGGAACCTGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872885 Original CRISPR CTCTCCAAGGCTGAGACACA GGG (reversed) Intronic