ID: 1057872890

View in Genome Browser
Species Human (GRCh38)
Location 9:98731589-98731611
Sequence TCCTGCTGGAGCCCTCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 0, 3: 35, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872890_1057872896 -6 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872896 9:98731606-98731628 GCAGGAAATGGGAACCTGGGAGG 0: 1
1: 0
2: 2
3: 37
4: 357
1057872890_1057872901 30 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 94
1057872890_1057872895 -9 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872895 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 265
1057872890_1057872898 16 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872890_1057872893 -10 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872890 Original CRISPR TCCTGCTGGAGCCCTCTCCA AGG (reversed) Intronic