ID: 1057872893

View in Genome Browser
Species Human (GRCh38)
Location 9:98731602-98731624
Sequence TCCAGCAGGAAATGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872886_1057872893 2 Left 1057872886 9:98731577-98731599 CCTGTGTCTCAGCCTTGGAGAGG 0: 1
1: 1
2: 1
3: 30
4: 236
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872890_1057872893 -10 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872883_1057872893 8 Left 1057872883 9:98731571-98731593 CCATGCCCTGTGTCTCAGCCTTG 0: 1
1: 0
2: 6
3: 51
4: 581
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872882_1057872893 23 Left 1057872882 9:98731556-98731578 CCGACACAAGGATGGCCATGCCC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272
1057872885_1057872893 3 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872893 9:98731602-98731624 TCCAGCAGGAAATGGGAACCTGG 0: 1
1: 0
2: 2
3: 12
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872893 Original CRISPR TCCAGCAGGAAATGGGAACC TGG Intronic