ID: 1057872894

View in Genome Browser
Species Human (GRCh38)
Location 9:98731603-98731625
Sequence CCCAGGTTCCCATTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872894_1057872901 16 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 94
1057872894_1057872898 2 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872894_1057872904 22 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872904 9:98731648-98731670 TGGCTCCACTCTGCTGGGCAGGG 0: 1
1: 0
2: 5
3: 19
4: 296
1057872894_1057872903 21 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872894_1057872902 17 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872902 9:98731643-98731665 CGAGATGGCTCCACTCTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872894 Original CRISPR CCCAGGTTCCCATTTCCTGC TGG (reversed) Intronic