ID: 1057872898

View in Genome Browser
Species Human (GRCh38)
Location 9:98731628-98731650
Sequence GTCCCTATGCTGATGCGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872894_1057872898 2 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872886_1057872898 28 Left 1057872886 9:98731577-98731599 CCTGTGTCTCAGCCTTGGAGAGG 0: 1
1: 1
2: 1
3: 30
4: 236
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872885_1057872898 29 Left 1057872885 9:98731576-98731598 CCCTGTGTCTCAGCCTTGGAGAG 0: 1
1: 1
2: 1
3: 28
4: 408
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42
1057872890_1057872898 16 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872898 9:98731628-98731650 GTCCCTATGCTGATGCGAGATGG 0: 1
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872898 Original CRISPR GTCCCTATGCTGATGCGAGA TGG Intronic