ID: 1057872899

View in Genome Browser
Species Human (GRCh38)
Location 9:98731630-98731652
Sequence AGCCATCTCGCATCAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872899_1057872909 11 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872909 9:98731664-98731686 GGCAGGGCCCCAAGTTGGCGGGG 0: 1
1: 0
2: 2
3: 5
4: 145
1057872899_1057872902 -10 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872902 9:98731643-98731665 CGAGATGGCTCCACTCTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 87
1057872899_1057872904 -5 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872904 9:98731648-98731670 TGGCTCCACTCTGCTGGGCAGGG 0: 1
1: 0
2: 5
3: 19
4: 296
1057872899_1057872908 10 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872908 9:98731663-98731685 GGGCAGGGCCCCAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 233
1057872899_1057872903 -6 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872899_1057872906 6 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872906 9:98731659-98731681 TGCTGGGCAGGGCCCCAAGTTGG 0: 1
1: 0
2: 3
3: 22
4: 259
1057872899_1057872916 27 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872916 9:98731680-98731702 GGCGGGGGTCCTGGAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1057872899_1057872910 12 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872910 9:98731665-98731687 GCAGGGCCCCAAGTTGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 184
1057872899_1057872907 9 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872907 9:98731662-98731684 TGGGCAGGGCCCCAAGTTGGCGG 0: 1
1: 0
2: 3
3: 28
4: 226
1057872899_1057872915 26 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1057872899_1057872912 18 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872912 9:98731671-98731693 CCCCAAGTTGGCGGGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872899 Original CRISPR AGCCATCTCGCATCAGCATA GGG (reversed) Intronic