ID: 1057872900

View in Genome Browser
Species Human (GRCh38)
Location 9:98731631-98731653
Sequence GAGCCATCTCGCATCAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872900_1057872904 -6 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872904 9:98731648-98731670 TGGCTCCACTCTGCTGGGCAGGG 0: 1
1: 0
2: 5
3: 19
4: 296
1057872900_1057872909 10 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872909 9:98731664-98731686 GGCAGGGCCCCAAGTTGGCGGGG 0: 1
1: 0
2: 2
3: 5
4: 145
1057872900_1057872916 26 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872916 9:98731680-98731702 GGCGGGGGTCCTGGAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1057872900_1057872903 -7 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872900_1057872915 25 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1057872900_1057872910 11 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872910 9:98731665-98731687 GCAGGGCCCCAAGTTGGCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 184
1057872900_1057872912 17 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872912 9:98731671-98731693 CCCCAAGTTGGCGGGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1057872900_1057872906 5 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872906 9:98731659-98731681 TGCTGGGCAGGGCCCCAAGTTGG 0: 1
1: 0
2: 3
3: 22
4: 259
1057872900_1057872907 8 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872907 9:98731662-98731684 TGGGCAGGGCCCCAAGTTGGCGG 0: 1
1: 0
2: 3
3: 28
4: 226
1057872900_1057872908 9 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872908 9:98731663-98731685 GGGCAGGGCCCCAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872900 Original CRISPR GAGCCATCTCGCATCAGCAT AGG (reversed) Intronic