ID: 1057872901

View in Genome Browser
Species Human (GRCh38)
Location 9:98731642-98731664
Sequence GCGAGATGGCTCCACTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872897_1057872901 -1 Left 1057872897 9:98731620-98731642 CCTGGGAGGTCCCTATGCTGATG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 94
1057872890_1057872901 30 Left 1057872890 9:98731589-98731611 CCTTGGAGAGGGCTCCAGCAGGA 0: 1
1: 1
2: 0
3: 35
4: 245
Right 1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 94
1057872894_1057872901 16 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872901 9:98731642-98731664 GCGAGATGGCTCCACTCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872901 Original CRISPR GCGAGATGGCTCCACTCTGC TGG Intronic