ID: 1057872902

View in Genome Browser
Species Human (GRCh38)
Location 9:98731643-98731665
Sequence CGAGATGGCTCCACTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872897_1057872902 0 Left 1057872897 9:98731620-98731642 CCTGGGAGGTCCCTATGCTGATG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1057872902 9:98731643-98731665 CGAGATGGCTCCACTCTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 87
1057872894_1057872902 17 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872902 9:98731643-98731665 CGAGATGGCTCCACTCTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 87
1057872899_1057872902 -10 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872902 9:98731643-98731665 CGAGATGGCTCCACTCTGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872902 Original CRISPR CGAGATGGCTCCACTCTGCT GGG Intronic