ID: 1057872903

View in Genome Browser
Species Human (GRCh38)
Location 9:98731647-98731669
Sequence ATGGCTCCACTCTGCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872894_1057872903 21 Left 1057872894 9:98731603-98731625 CCAGCAGGAAATGGGAACCTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872900_1057872903 -7 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872899_1057872903 -6 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246
1057872897_1057872903 4 Left 1057872897 9:98731620-98731642 CCTGGGAGGTCCCTATGCTGATG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1057872903 9:98731647-98731669 ATGGCTCCACTCTGCTGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872903 Original CRISPR ATGGCTCCACTCTGCTGGGC AGG Intronic