ID: 1057872905

View in Genome Browser
Species Human (GRCh38)
Location 9:98731653-98731675
Sequence TGGGGCCCTGCCCAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 400}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872905_1057872912 -5 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872912 9:98731671-98731693 CCCCAAGTTGGCGGGGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 117
1057872905_1057872920 20 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872920 9:98731696-98731718 CAAAGGGAGTTCTCAAGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 267
1057872905_1057872915 3 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1057872905_1057872919 16 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872919 9:98731692-98731714 GGAGCAAAGGGAGTTCTCAAGGG 0: 1
1: 0
2: 1
3: 15
4: 226
1057872905_1057872918 15 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872918 9:98731691-98731713 TGGAGCAAAGGGAGTTCTCAAGG 0: 1
1: 0
2: 1
3: 15
4: 213
1057872905_1057872921 21 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872921 9:98731697-98731719 AAAGGGAGTTCTCAAGGGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 281
1057872905_1057872923 29 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872923 9:98731705-98731727 TTCTCAAGGGCAGGGAGAGGTGG 0: 1
1: 1
2: 8
3: 54
4: 761
1057872905_1057872922 26 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872922 9:98731702-98731724 GAGTTCTCAAGGGCAGGGAGAGG 0: 1
1: 0
2: 5
3: 37
4: 379
1057872905_1057872916 4 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872916 9:98731680-98731702 GGCGGGGGTCCTGGAGCAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872905 Original CRISPR TGGGGCCCTGCCCAGCAGAG TGG (reversed) Intronic