ID: 1057872906

View in Genome Browser
Species Human (GRCh38)
Location 9:98731659-98731681
Sequence TGCTGGGCAGGGCCCCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872899_1057872906 6 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872906 9:98731659-98731681 TGCTGGGCAGGGCCCCAAGTTGG 0: 1
1: 0
2: 3
3: 22
4: 259
1057872897_1057872906 16 Left 1057872897 9:98731620-98731642 CCTGGGAGGTCCCTATGCTGATG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1057872906 9:98731659-98731681 TGCTGGGCAGGGCCCCAAGTTGG 0: 1
1: 0
2: 3
3: 22
4: 259
1057872900_1057872906 5 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872906 9:98731659-98731681 TGCTGGGCAGGGCCCCAAGTTGG 0: 1
1: 0
2: 3
3: 22
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872906 Original CRISPR TGCTGGGCAGGGCCCCAAGT TGG Intronic