ID: 1057872908

View in Genome Browser
Species Human (GRCh38)
Location 9:98731663-98731685
Sequence GGGCAGGGCCCCAAGTTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872899_1057872908 10 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872908 9:98731663-98731685 GGGCAGGGCCCCAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 233
1057872897_1057872908 20 Left 1057872897 9:98731620-98731642 CCTGGGAGGTCCCTATGCTGATG 0: 1
1: 0
2: 2
3: 28
4: 201
Right 1057872908 9:98731663-98731685 GGGCAGGGCCCCAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 233
1057872900_1057872908 9 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872908 9:98731663-98731685 GGGCAGGGCCCCAAGTTGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872908 Original CRISPR GGGCAGGGCCCCAAGTTGGC GGG Intronic