ID: 1057872915

View in Genome Browser
Species Human (GRCh38)
Location 9:98731679-98731701
Sequence TGGCGGGGGTCCTGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057872899_1057872915 26 Left 1057872899 9:98731630-98731652 CCCTATGCTGATGCGAGATGGCT 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1057872905_1057872915 3 Left 1057872905 9:98731653-98731675 CCACTCTGCTGGGCAGGGCCCCA 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211
1057872900_1057872915 25 Left 1057872900 9:98731631-98731653 CCTATGCTGATGCGAGATGGCTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1057872915 9:98731679-98731701 TGGCGGGGGTCCTGGAGCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057872915 Original CRISPR TGGCGGGGGTCCTGGAGCAA AGG Intronic