ID: 1057873106

View in Genome Browser
Species Human (GRCh38)
Location 9:98732861-98732883
Sequence TTCTAGATCGTCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057873106_1057873110 17 Left 1057873106 9:98732861-98732883 CCTTCCTCCCTGACGATCTAGAA 0: 1
1: 1
2: 0
3: 3
4: 96
Right 1057873110 9:98732901-98732923 GCCTTTGCACATGCCCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057873106 Original CRISPR TTCTAGATCGTCAGGGAGGA AGG (reversed) Exonic
900096958 1:943692-943714 TTCCAGGTCTTCAGGGAGCAGGG + Exonic
903010441 1:20326300-20326322 TTCTAGATCATGAAGGATGACGG + Intronic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
908615664 1:65919011-65919033 TTCTAGTTCTTCAGAGTGGAAGG + Intronic
921280670 1:213563706-213563728 TTCTAGATTGTTAAGGAGTAAGG + Intergenic
1065627370 10:27645491-27645513 TTCTGGAGCCTCAGGGAGGATGG - Intergenic
1074184033 10:111085958-111085980 ATCTGCATAGTCAGGGAGGAAGG - Intergenic
1078285485 11:9950214-9950236 TTCTACATTGTCAGGGAGATTGG - Intronic
1078915272 11:15772951-15772973 TTCTTGATCCTCTGGGTGGAAGG - Intergenic
1080617812 11:33960214-33960236 TTCTAGAAGGTCAGGGTGGGGGG + Intergenic
1083627024 11:64077137-64077159 TTCTCCATCATCAGGGAGAAGGG - Intronic
1084376770 11:68783222-68783244 TTCTGGTTGGGCAGGGAGGAGGG - Intronic
1084858770 11:72004923-72004945 TTCTACCTCGTGAGGCAGGAAGG - Intronic
1085642707 11:78202798-78202820 TTCTACATCGAAAGGGAGGTAGG + Intronic
1087772822 11:102228924-102228946 ATCTAGATAATCAGAGAGGAGGG - Intronic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1091224822 11:133951028-133951050 TCCTGGCTTGTCAGGGAGGAGGG - Intronic
1092256717 12:6929954-6929976 TTCTACAAGGTCAGGGAAGAAGG - Intronic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1094435602 12:30417816-30417838 AGCTAAATCCTCAGGGAGGATGG - Intergenic
1095331635 12:40972231-40972253 TTGTAGATCGTTTGGGTGGAAGG + Intronic
1100331170 12:93583562-93583584 GTCTTGATAGTCAAGGAGGAGGG + Intergenic
1101126593 12:101641734-101641756 TTCTAAATCGGCAGGGGGAAAGG - Intronic
1103232525 12:119343818-119343840 TTCTAATACATCAGGGAGGAAGG + Intronic
1109171177 13:59099064-59099086 TTCTAGATAGTTTAGGAGGAAGG + Intergenic
1111524186 13:89447032-89447054 TGCTACATCGTAAAGGAGGAAGG - Intergenic
1114157876 14:20127752-20127774 TTCTGGTTGGTCAGAGAGGAAGG + Intergenic
1114501738 14:23174747-23174769 TTCCAGATCTCCAGGGAGAAGGG + Intronic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1122822399 14:104354191-104354213 TTCTCAATTATCAGGGAGGAGGG + Intergenic
1126111535 15:45178025-45178047 TTCCAGGTCCTTAGGGAGGATGG - Intronic
1126544563 15:49858778-49858800 ATCTAAATAGTCAGTGAGGAAGG - Exonic
1129596946 15:76972991-76973013 TTCTGGAGCCACAGGGAGGATGG - Intergenic
1130809136 15:87358464-87358486 TTCTAGATCTCCATGGATGAGGG - Intergenic
1133691085 16:8216020-8216042 TCCTAGTTCTTCAGGGAGGGTGG - Intergenic
1134078907 16:11311423-11311445 TTTTAGTTGGTCAGGGAGGTGGG + Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1153027583 18:685594-685616 TCCTAGCTCCTCAGGTAGGAGGG - Intronic
1157415451 18:47498655-47498677 TTCTACTTCTTCAGGGAGGTGGG - Intergenic
1157597620 18:48873434-48873456 TTCTAGTTTTCCAGGGAGGAAGG + Intergenic
1163739088 19:18999731-18999753 TCCTTCATGGTCAGGGAGGAGGG - Intronic
1165424149 19:35736776-35736798 TTCGAGATCAGCAGTGAGGATGG + Exonic
1166546064 19:43635521-43635543 TCCTAGGTCTTGAGGGAGGAAGG - Intronic
1167035422 19:46992544-46992566 CTCCAGATAGGCAGGGAGGAGGG - Intronic
1168095905 19:54114785-54114807 TTCTAGGATCTCAGGGAGGAGGG - Intronic
925855280 2:8123624-8123646 TTCCAGCTCTTCAGGGAGGCAGG + Intergenic
938678367 2:133662366-133662388 TTCTAGAGAGTTAGGGAGAAAGG - Intergenic
944050174 2:195459203-195459225 CTCTAGATAGTCATGAAGGAAGG + Intergenic
945140315 2:206679388-206679410 GTCTAGATTGTCAAGGAGAAGGG - Intronic
946909240 2:224443558-224443580 TTCCTGATGCTCAGGGAGGAAGG - Intergenic
1169208972 20:3755148-3755170 TTCTAGAGGGTTAGGGAGGCAGG + Intronic
1169910628 20:10645003-10645025 TTCTGGATACTCAGGGAGGGTGG - Intronic
1170995946 20:21359038-21359060 TTCTAGAGGGTTAGGCAGGAAGG - Intronic
1171174236 20:23039338-23039360 TCCCAGATGGTCAGGGAAGATGG + Intergenic
1171182346 20:23100051-23100073 TTCTAGATCTTCAGGCATGCTGG - Intergenic
1172408435 20:34705570-34705592 TCCTAGGTCGTCAGCTAGGAAGG + Intronic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1178098342 21:29239385-29239407 TTCTGGAAAGTCAAGGAGGATGG + Intronic
1178708338 21:34891428-34891450 TTTTAGATCCTCAGTAAGGAAGG - Intronic
1178999868 21:37447123-37447145 TCATAGATTGACAGGGAGGAAGG - Intronic
1179637017 21:42719228-42719250 TTTTAGGTTGTCAGAGAGGATGG - Intronic
1183658436 22:39204499-39204521 TTCTAGATGGCGAGGGAAGAGGG + Intergenic
1183952891 22:41361762-41361784 TTCCAGAATGTCAGGGCGGAAGG - Intergenic
949805981 3:7956406-7956428 TTCTAGTTCCCCAGGGATGAGGG - Intergenic
950573882 3:13819227-13819249 TTCTTGATCTTCAGGAAGGTGGG + Exonic
950955072 3:17044226-17044248 TTCTGGAGAGTGAGGGAGGAAGG + Intronic
953897051 3:46810978-46811000 TTTTAGTAAGTCAGGGAGGAGGG - Intronic
955640084 3:61073129-61073151 TTCAAGACCTACAGGGAGGAGGG - Intronic
955774021 3:62414805-62414827 TTCTTGACCTCCAGGGAGGACGG + Intronic
957178309 3:76841739-76841761 TTCTAAATCCTCAAGAAGGAAGG + Intronic
963742091 3:149090671-149090693 TTCAAGAATGTCAGGCAGGAGGG + Intergenic
967442305 3:189522809-189522831 TTCCAGAACATCAAGGAGGAGGG + Intergenic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
969971640 4:11054022-11054044 TTCCACCTCTTCAGGGAGGATGG + Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
978000086 4:103547001-103547023 TTGTTGATTGTCAGGGATGAAGG + Intergenic
981405942 4:144369249-144369271 TTCCTGATGGTCAGGGAGTAGGG + Intergenic
983860232 4:172696698-172696720 TTCCACATGGTCAGGGAGGTTGG - Intronic
989166858 5:38440860-38440882 TTCTGGATCGTCAGTGAGTCTGG + Intronic
990205421 5:53424000-53424022 TCATAGCTCCTCAGGGAGGAGGG - Intergenic
993516044 5:88836320-88836342 TACTAGATAGACAGGGAGGGAGG - Intronic
1001580308 5:172793744-172793766 TGCTTGAGCTTCAGGGAGGAAGG - Intergenic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1007393933 6:41566583-41566605 CTCTAGATCCTCAGAGAGGTTGG - Intronic
1007652584 6:43432588-43432610 TTCTTGATCCTCGGGCAGGAGGG - Exonic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1017572134 6:155757227-155757249 TTCTAGATCTTGACGGAGGCTGG + Intergenic
1019353539 7:567047-567069 TTCTAGAACGACTGGGAGAAAGG + Intronic
1022736174 7:33078204-33078226 TTCTAAATTGTTAGGAAGGAAGG - Intergenic
1033072268 7:138214888-138214910 TTCTTGATGGCCAGGGAGGTGGG + Intergenic
1033929320 7:146504404-146504426 TTGTTGATTGTCAGGGATGAAGG + Intronic
1035003645 7:155638344-155638366 TTCTGGATTGTGAGGCAGGAAGG - Intronic
1047214286 8:122864173-122864195 TTCTAGATCACCAGGGAACAGGG - Intronic
1048208609 8:132435832-132435854 TTCAAGAACCTCAGGGCGGAAGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1058980366 9:110163483-110163505 TGCGAGATTGTAAGGGAGGAGGG - Intronic
1193156704 X:78182486-78182508 TTCTGGATCATCATGGTGGATGG + Intergenic