ID: 1057873307

View in Genome Browser
Species Human (GRCh38)
Location 9:98734029-98734051
Sequence TTATAGATCGTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057873307_1057873317 19 Left 1057873307 9:98734029-98734051 CCCTCCTCCCTGACGATCTATAA 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1057873317 9:98734071-98734093 CTCCACACATGCCCCCGCTGGGG 0: 1
1: 1
2: 2
3: 21
4: 182
1057873307_1057873316 18 Left 1057873307 9:98734029-98734051 CCCTCCTCCCTGACGATCTATAA 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1057873316 9:98734070-98734092 CCTCCACACATGCCCCCGCTGGG 0: 1
1: 1
2: 3
3: 14
4: 145
1057873307_1057873314 17 Left 1057873307 9:98734029-98734051 CCCTCCTCCCTGACGATCTATAA 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1057873314 9:98734069-98734091 GCCTCCACACATGCCCCCGCTGG 0: 1
1: 0
2: 5
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057873307 Original CRISPR TTATAGATCGTCAGGGAGGA GGG (reversed) Exonic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
916184215 1:162115018-162115040 TTATAGCTCCTCATGGAAGAAGG + Intronic
920628275 1:207625658-207625680 TTATAGATCATTTGGTAGGAAGG + Intronic
920638413 1:207727847-207727869 TTATAGATCATTTGGTAGGAAGG + Intronic
1065395571 10:25233210-25233232 TTATAGCTCTTCAGGAAAGAGGG + Intronic
1065627370 10:27645491-27645513 TTCTGGAGCCTCAGGGAGGATGG - Intergenic
1067203020 10:44190755-44190777 TCATACATTGTCTGGGAGGAGGG + Intergenic
1072948765 10:99834561-99834583 TTATAGATAGAGAGGAAGGAAGG - Intronic
1078865534 11:15293871-15293893 TCACAGATCGTCAGAGAGAAGGG - Intergenic
1081660743 11:44886694-44886716 TTACAGATCTTTAGGAAGGAAGG - Intronic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1090560561 11:127927677-127927699 CTATAGTTAGTCAGGGAGGGAGG + Intergenic
1090652357 11:128818711-128818733 TCATAGACCGTCAGGGAAGTAGG + Intergenic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1095331635 12:40972231-40972253 TTGTAGATCGTTTGGGTGGAAGG + Intronic
1095578581 12:43768185-43768207 TTATTGATCCTCAAGAAGGATGG + Exonic
1098601322 12:72334807-72334829 TTACAGATCCTGAGCGAGGAGGG + Intronic
1098627305 12:72688219-72688241 TTAGAGATCTTAAGGAAGGAAGG + Intergenic
1109906414 13:68847284-68847306 CTATATATAATCAGGGAGGAGGG + Intergenic
1113343333 13:109447839-109447861 TTATAGGTCCTCAAGGAGGCTGG + Intergenic
1115221081 14:31059004-31059026 TTATTAATCATCAAGGAGGAGGG - Intronic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1133155838 16:3875260-3875282 TCAAAGGTCGTCAGGGATGAAGG - Intronic
1134078907 16:11311423-11311445 TTTTAGTTGGTCAGGGAGGTGGG + Intronic
1144939331 17:18926608-18926630 TTATAGATCCACAGGAAGTAGGG + Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147531258 17:41280388-41280410 TTATAGATCTTCTGAGAGTAAGG - Intergenic
1149705565 17:58691780-58691802 TTACAGAACTTCGGGGAGGAAGG - Intronic
1149812451 17:59690423-59690445 TTATAAACCCTCAGGAAGGAGGG - Intronic
1159757252 18:72380788-72380810 TAATAGCTGGGCAGGGAGGAGGG + Intergenic
1159961529 18:74559080-74559102 GTATAGAAGGTCAGGCAGGACGG - Intronic
1163476109 19:17527066-17527088 TCATAGCTCGTCTTGGAGGAGGG - Intronic
1167111088 19:47461799-47461821 TTATTGACCTGCAGGGAGGAAGG - Intronic
928082280 2:28322032-28322054 TAATAGATCCTTAGGAAGGAAGG + Intronic
934630799 2:95919244-95919266 TGATGGATTGTCAGGCAGGAAGG - Intronic
942799966 2:179863175-179863197 TTAAAAATAGACAGGGAGGAGGG - Intergenic
947967410 2:234292907-234292929 TGAAAGATCATCAGTGAGGAAGG + Intergenic
948279851 2:236738742-236738764 ATATAGTTCATCAGGTAGGAAGG + Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG + Intergenic
1178708338 21:34891428-34891450 TTTTAGATCCTCAGTAAGGAAGG - Intronic
1178999868 21:37447123-37447145 TCATAGATTGACAGGGAGGAAGG - Intronic
1179637017 21:42719228-42719250 TTTTAGGTTGTCAGAGAGGATGG - Intronic
1182045902 22:27273954-27273976 TCATGAATCGTCAGGCAGGAAGG - Intergenic
953897051 3:46810978-46811000 TTTTAGTAAGTCAGGGAGGAGGG - Intronic
960325199 3:116286964-116286986 TTATAGATAGAAAGGGATGAGGG - Intronic
962559954 3:136595411-136595433 TTATAGAAGGTCAGTGAGAATGG - Intronic
963211133 3:142692118-142692140 TTATTAATGGTCAGGGAGGGAGG + Intronic
964671471 3:159230631-159230653 TCATCGCTTGTCAGGGAGGAAGG - Intronic
965638062 3:170804411-170804433 TTATAGATCTTCTGGGCTGAAGG - Intronic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
978000086 4:103547001-103547023 TTGTTGATTGTCAGGGATGAAGG + Intergenic
990205421 5:53424000-53424022 TCATAGCTCCTCAGGGAGGAGGG - Intergenic
994324997 5:98437473-98437495 TGATCGATCGCCAGGGAGGGAGG - Intergenic
998734677 5:145122999-145123021 TTATAAATTGTGAGGGAGGGAGG - Intergenic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001462827 5:171933338-171933360 TTAGTGATTGTCAGGAAGGATGG + Intronic
1001818935 5:174694545-174694567 TTATTGATCCTCAGGAGGGAGGG - Intergenic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1007294323 6:40810358-40810380 TTATAGGTGGTCAGGAATGAGGG - Intergenic
1007349471 6:41258433-41258455 TTATAGTTCATCAGGGAAGTGGG - Intergenic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1007895584 6:45354036-45354058 TTAAAAATTGTCAGGGAAGATGG + Intronic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1009602358 6:65818480-65818502 TTATACATTTTCAGGGAGTACGG + Intergenic
1012426631 6:99122073-99122095 TTAGAGACTGTCAGTGAGGAAGG - Intergenic
1013024401 6:106255782-106255804 TTAAAGATTGTCATGGATGAAGG - Intronic
1018184176 6:161251602-161251624 TTAAAGACCCGCAGGGAGGATGG + Intronic
1020901203 7:14005531-14005553 ATAGAGATCATCAGGGAGAAGGG - Intergenic
1023360585 7:39411193-39411215 GGATAGTTCGGCAGGGAGGAGGG + Intronic
1033551729 7:142453502-142453524 TTATAGACCCTCTGGGTGGAGGG - Intergenic
1033929320 7:146504404-146504426 TTGTTGATTGTCAGGGATGAAGG + Intronic
1035925947 8:3727918-3727940 TCAAAGAGCGGCAGGGAGGAGGG + Intronic
1036986322 8:13535267-13535289 TCATAGGTTGTCAGGAAGGAAGG + Intergenic
1042703529 8:71642979-71643001 TAAGAGAGGGTCAGGGAGGATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057714470 9:97480048-97480070 TTAGAGCTCCTGAGGGAGGAAGG + Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1059653513 9:116336553-116336575 TTATGGATGGTCAGGAAGGCTGG - Intronic
1060258972 9:122057145-122057167 TTAAAGGTGTTCAGGGAGGATGG + Intronic
1190505768 X:51124922-51124944 TTATAGATTCTCAGGCAAGATGG + Intergenic
1192588456 X:72339676-72339698 TGAGAGATTGTCAGGGAGCAGGG + Intronic
1192589042 X:72344727-72344749 TTATAGAGGATCAGGGAGAAAGG - Intronic
1194597430 X:95876001-95876023 TTATATATCATCAGGAGGGATGG - Intergenic
1195713297 X:107792874-107792896 TTAGAGATATTCATGGAGGAAGG - Intronic
1198968166 X:142249996-142250018 ACATAGATCGTCATGTAGGAGGG - Intergenic