ID: 1057875830

View in Genome Browser
Species Human (GRCh38)
Location 9:98753934-98753956
Sequence TTTATAGGACATGCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057875830_1057875838 28 Left 1057875830 9:98753934-98753956 CCAGCTTGGGCATGTCCTATAAA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1057875838 9:98753985-98754007 CCCATCTCTTCCCAGTGTCGTGG No data
1057875830_1057875833 -5 Left 1057875830 9:98753934-98753956 CCAGCTTGGGCATGTCCTATAAA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1057875833 9:98753952-98753974 ATAAACTGAACAGTCGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057875830 Original CRISPR TTTATAGGACATGCCCAAGC TGG (reversed) Intronic
900755512 1:4431804-4431826 ATTCCAGGACATGACCAAGCAGG + Intergenic
907160703 1:52366557-52366579 CTTAAAGGACATGGACAAGCAGG - Intergenic
909749038 1:79135989-79136011 TTTATATGACATGCAAAATCAGG - Intergenic
910425916 1:87120009-87120031 TTTCTAGGATATGCTCAGGCAGG - Intronic
924870626 1:248040195-248040217 TTTTAAGCACATGCCTAAGCAGG - Intronic
1064385160 10:14883898-14883920 TTTATATGAAATGTCCAACCAGG - Intronic
1068373281 10:56147078-56147100 CTTATAGTACAGGCCCAAGGGGG - Intergenic
1070253941 10:74797913-74797935 GTTATGGGACTTGCCCAAGTTGG - Intergenic
1073607585 10:104911784-104911806 TCTTGAGAACATGCCCAAGCAGG - Intronic
1074548155 10:114418016-114418038 TTTATAGAGGAAGCCCAAGCAGG + Intergenic
1075073619 10:119335657-119335679 TTTAAAGAACATGCGCAGGCTGG - Intronic
1075244545 10:120809328-120809350 CTTATATGACTTACCCAAGCAGG - Intergenic
1076890192 10:133279580-133279602 TTTATAGAAGCTGCCCAGGCAGG - Exonic
1083348162 11:62008619-62008641 TTTATATGAAATGTCCAGGCTGG + Intergenic
1088644221 11:111903798-111903820 TTTATAGGAAATGTCCAAAATGG + Intergenic
1089020084 11:115204719-115204741 TGTATAGAATATGCCCAAGTGGG - Intronic
1089271973 11:117307650-117307672 TTTATTGGAGAGGCCCAAGAAGG + Intronic
1091880639 12:3974671-3974693 TTTATAGGCCATGCAAAAACAGG - Intergenic
1101535932 12:105616525-105616547 CTTATAGGACATGCCCCACTGGG + Intergenic
1104018334 12:124975240-124975262 TTTCCAGGACCTGCCCAAGCAGG - Intronic
1107364251 13:39653421-39653443 TTTATATGAAATGTCCAAACTGG + Intergenic
1107517786 13:41148546-41148568 GTTATAAGACATGCCTCAGCAGG + Intergenic
1114628641 14:24145903-24145925 ATGAAAGGACTTGCCCAAGCTGG + Intronic
1117625439 14:57632723-57632745 TTTTTTTGACATGCCCAGGCTGG + Intronic
1118880420 14:69820905-69820927 TTTATAGCACATCCGCATGCTGG + Intergenic
1119702801 14:76766736-76766758 TTTAGAGGAGATGTCCAGGCTGG - Intronic
1125570628 15:40715060-40715082 TTAAAAGCACATGCCCATGCGGG + Intronic
1128092648 15:64929479-64929501 TTTAAAGGACAACCCCACGCAGG + Intronic
1128600552 15:68991994-68992016 GTTATAAGACATGCCTGAGCAGG - Intronic
1128823909 15:70691927-70691949 TTTAAAGGAAATGCCAAAGGGGG + Intronic
1130315504 15:82791797-82791819 TTTATAGGAAATGTCCAAACAGG - Intronic
1137409711 16:48217736-48217758 TTTCCAGGACATGCCCTAGTGGG + Intronic
1138348950 16:56336256-56336278 GGCTTAGGACATGCCCAAGCTGG - Intronic
1139966983 16:70751235-70751257 TTGACAGGAAATCCCCAAGCTGG + Intronic
1145308072 17:21686340-21686362 TTTACAGGACATGTGCAAACAGG + Intergenic
1146565183 17:33906896-33906918 TCCATGGGACATGCCTAAGCTGG + Intronic
1146797700 17:35794796-35794818 TTTAAATGGCTTGCCCAAGCAGG + Intronic
1152066031 17:78112972-78112994 TTCATTGGGGATGCCCAAGCCGG + Exonic
1152792916 17:82291959-82291981 TTTTTAGTACATGCCCAACGCGG + Intergenic
1155658542 18:28220504-28220526 TGTAAAGAACATGCCCAAGATGG + Intergenic
1156014209 18:32528924-32528946 TTTATAGGTAATGCACAAGTGGG - Intergenic
926260872 2:11259873-11259895 TTTATATTAAATGACCAAGCTGG + Intronic
929969269 2:46559797-46559819 TTTATATGACTAGCCCAAGGGGG - Intronic
932097927 2:68868306-68868328 TTTATAGGAGATGTCAGAGCTGG - Intronic
933083871 2:78029888-78029910 GTTACAAGACATGCCTAAGCAGG - Intergenic
943272254 2:185821569-185821591 TTTATAGATCATGACCAAGTCGG + Intronic
944872027 2:203921797-203921819 TTTATCAGACATTTCCAAGCAGG - Intergenic
945242927 2:207693112-207693134 TTTATTGGGCTTGCCCAGGCTGG - Intergenic
946720925 2:222606399-222606421 TTTAAAAGTCATGCCAAAGCTGG + Intronic
1169573793 20:6935746-6935768 TTTATATCACATACTCAAGCTGG + Intergenic
1171806704 20:29687663-29687685 TTTACAGGACATGAGCAAACAGG - Intergenic
1177278617 21:18949544-18949566 TTTATATGACATTTCCAAACAGG - Intergenic
1177376575 21:20278262-20278284 TTTATAATAGATGCCCAAACAGG + Intergenic
1178546991 21:33500659-33500681 TTTATATGAAATGTCCAGGCTGG - Intergenic
958121236 3:89291797-89291819 TTTATAGGACATGTGCCAGCTGG + Intronic
960381035 3:116962158-116962180 TTTATAGGTCATTCCCTTGCTGG + Intronic
960590219 3:119358766-119358788 TTTATAGGAAATGTCCAAAACGG + Intronic
961129199 3:124449760-124449782 TTTATATGAAATGCCCAAACAGG - Intronic
971456711 4:26852005-26852027 TTCAGAGGAAAAGCCCAAGCTGG - Intergenic
972651765 4:41024761-41024783 ATTATAAGACATGCCTGAGCAGG + Intronic
973043729 4:45508560-45508582 ATTATATGACATGACCAAGTGGG - Intergenic
978704181 4:111685783-111685805 TTTATAGGATATACCCAATGTGG + Intergenic
980973765 4:139590624-139590646 TTTAGAGTATATGCCAAAGCAGG + Intronic
982819265 4:159926278-159926300 GTTATAAGACATGCCTGAGCAGG - Intergenic
983404499 4:167310892-167310914 TTTATATAACATGCAAAAGCCGG + Intergenic
988491801 5:31711487-31711509 TTTAAAGGACACGCACAAGCTGG + Intronic
989413104 5:41142642-41142664 TGAATAAGACATGCCCAAACAGG + Exonic
989758348 5:44983517-44983539 ATTATAAGACATGCCTGAGCAGG - Intergenic
990221356 5:53592899-53592921 TTTATATACCATGACCAAGCAGG - Intronic
991018561 5:61957435-61957457 TTTGTAGGACATGATGAAGCTGG + Intergenic
992203666 5:74409143-74409165 TTTTCAGGTAATGCCCAAGCAGG + Intergenic
995851255 5:116548265-116548287 TTTAGATGCCATGCCCAAGGTGG + Intronic
998281742 5:140816146-140816168 TTGATAGGACATCCTCGAGCAGG - Intronic
999666781 5:153921082-153921104 GTGATAAGACAAGCCCAAGCAGG + Intergenic
1002117675 5:176976702-176976724 TTTATAAGACATGCCCAGAATGG + Intronic
1005943470 6:30578703-30578725 TTTAGAATACATGCCCAGGCTGG + Intronic
1009992249 6:70858086-70858108 TTTATGGGAAATGCACAAACTGG + Exonic
1011504967 6:88031422-88031444 GTTATAAGACATGCCTGAGCAGG + Intergenic
1013262632 6:108461425-108461447 TTTATAGGACATGATCCAGTAGG + Intronic
1017752872 6:157504709-157504731 TTTTTAAGATATGCCCATGCAGG - Intronic
1019463781 7:1175346-1175368 TCCATGGGACAGGCCCAAGCAGG - Intergenic
1021687324 7:23199709-23199731 TTCAAAGAACATGCCCAATCTGG - Intronic
1025086357 7:56026707-56026729 TTCATACTACATGCCCAGGCAGG + Intronic
1025284195 7:57649286-57649308 TTTACAGGACATGTGCAAGCAGG + Intergenic
1035386403 7:158475620-158475642 TTTTTAGGACATGCCCCTGCTGG + Intronic
1040002990 8:42594976-42594998 TTTCTATGTCATGCCCTAGCAGG + Intergenic
1040577979 8:48670987-48671009 TTTTTAAGAGATGCCCAGGCTGG + Intergenic
1041043309 8:53867996-53868018 ATTATAGGCCTTGCCAAAGCTGG + Intronic
1042525730 8:69762923-69762945 TTTAAAGCACATGCCCAAAGGGG + Intronic
1042715440 8:71767298-71767320 TTTGTAGGAAATGCCCAAACTGG + Intergenic
1043802842 8:84632512-84632534 TTTGTAGGATATGACAAAGCAGG - Intronic
1045378715 8:101601356-101601378 TTTATAGAAAATGCCTAACCTGG + Intronic
1047900290 8:129413704-129413726 AGGATAGGACATGCCCAATCAGG + Intergenic
1057875830 9:98753934-98753956 TTTATAGGACATGCCCAAGCTGG - Intronic
1058152104 9:101474900-101474922 ATTATATGACCTGCCCAAGGTGG + Exonic
1058473900 9:105310625-105310647 TTTATAGGAAAAGGCTAAGCAGG + Intronic
1059307918 9:113369162-113369184 TTTCTAGGACACGTCCAATCTGG + Intronic
1189497169 X:41519325-41519347 TTTATAGCAAATGCCTAAACTGG + Intronic
1189597251 X:42582461-42582483 TTTATGGGACATAGGCAAGCTGG - Intergenic
1190690947 X:52912736-52912758 TTTATAGGAAATGCCCAGAGAGG + Intergenic
1190695036 X:52943056-52943078 TTTATAGGAAATGCCCAGAGAGG - Intronic
1192568311 X:72181701-72181723 TGTTTAGGACATGCCCATGGCGG + Exonic
1194853639 X:98901003-98901025 TTTAAGGGACTTGCCCAAGGTGG - Intergenic
1195869805 X:109474140-109474162 ATTATAGGCCAGGCCTAAGCTGG + Intronic
1199635566 X:149808748-149808770 ATTGTAGGAGAGGCCCAAGCAGG - Intergenic