ID: 1057875832

View in Genome Browser
Species Human (GRCh38)
Location 9:98753949-98753971
Sequence GAGCCGACTGTTCAGTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057875832_1057875838 13 Left 1057875832 9:98753949-98753971 CCTATAAACTGAACAGTCGGCTC 0: 1
1: 0
2: 2
3: 1
4: 44
Right 1057875838 9:98753985-98754007 CCCATCTCTTCCCAGTGTCGTGG No data
1057875832_1057875840 22 Left 1057875832 9:98753949-98753971 CCTATAAACTGAACAGTCGGCTC 0: 1
1: 0
2: 2
3: 1
4: 44
Right 1057875840 9:98753994-98754016 TCCCAGTGTCGTGGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057875832 Original CRISPR GAGCCGACTGTTCAGTTTAT AGG (reversed) Intronic
905956432 1:42001253-42001275 GAGCTGACAGTTCAGTGTCTAGG - Intronic
906908198 1:49917951-49917973 GAGCAGGTTGTTCAGTTTCTAGG - Intronic
907542768 1:55231285-55231307 GAGAGGAGGGTTCAGTTTATGGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
908859339 1:68465423-68465445 GAGCAAACTGTTCTGTTCATGGG + Intergenic
924891901 1:248291749-248291771 GAGGCCTCTGTTCTGTTTATTGG - Intergenic
1068713966 10:60166927-60166949 GAGCAGACTGTACATTTTAATGG + Intronic
1076870113 10:133188852-133188874 GAGCCGCCTGTTCCGTTCACCGG - Intronic
1094140508 12:27176165-27176187 GAGCCAATTGTTTAATTTATAGG + Intergenic
1104290853 12:127465618-127465640 GAGCTGACTCTTATGTTTATGGG + Intergenic
1108415386 13:50193199-50193221 GAGCTGATTGTTAAGTTTAGGGG + Intronic
1118990378 14:70792153-70792175 GAGCATCCTGTTCAGTTGATGGG - Intronic
1121029912 14:90649551-90649573 TAGCCAGGTGTTCAGTTTATGGG - Intronic
1121497419 14:94403555-94403577 GAGCCCACTGTTCTTTTCATGGG - Intergenic
1140772487 16:78217599-78217621 GAGCCCTCTGTTAAGTTTCTCGG - Intronic
1149446357 17:56716261-56716283 GAACCCAGTGTTCAGTTTCTTGG - Intergenic
1155324174 18:24649552-24649574 GAGCCAAGTGTTCAATTTTTAGG + Intergenic
1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG + Intergenic
934625612 2:95847966-95847988 GAGCTTTCTGTTCAGGTTATCGG + Intronic
934807959 2:97253351-97253373 GAGCCGTCTGTTCAGGTTATCGG - Intronic
934829551 2:97503836-97503858 GAGCCGTCTGTTCAGGTTATCGG + Intronic
939170872 2:138693778-138693800 GAGCAGGCTGTTCTGTTGATGGG - Intronic
946949339 2:224855797-224855819 GAGCTGAATGTTCAATTTTTAGG + Intronic
1177196682 21:17910981-17911003 GAGCCAATTGTTAAGTTTTTAGG + Intronic
1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG + Intergenic
1184495722 22:44840147-44840169 GAAGCAACTGTTCAGTTTCTGGG - Intronic
955314630 3:57926081-57926103 TAGTTGACTGTTCAGTTCATTGG - Intronic
962053720 3:131846697-131846719 GAGATGACTGTTCAGTTTTCTGG + Intronic
976698546 4:87944332-87944354 GAGCTGACTGTTAAATTTCTGGG - Intergenic
979918442 4:126469416-126469438 GAACCGACTGTTTATGTTATTGG + Intergenic
982733690 4:158982590-158982612 GAGCAGATTGTTCAGTTTCCAGG - Intronic
990364585 5:55057305-55057327 GAGCCAACTGTTAAATTTTTAGG - Intergenic
992761383 5:79953753-79953775 GAGCTGATTGTTCAGGTTAGGGG - Intergenic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
999100679 5:149023169-149023191 GGGCAGACTGTTCTGTTTGTGGG + Intronic
1015590530 6:134818500-134818522 GAGCCCACTTTCCACTTTATGGG - Intergenic
1018071746 6:160170831-160170853 GAGATGACTGTCCGGTTTATGGG + Intergenic
1035611644 8:969501-969523 GAACCAACTGTTAAGTTTTTAGG + Intergenic
1038376518 8:27045381-27045403 GAGCCAACTGTTAAGTTTTCAGG + Intergenic
1039179536 8:34849983-34850005 GTGCCCTCTGGTCAGTTTATTGG - Intergenic
1041488551 8:58406581-58406603 GAGCCTACTGTTAAATTTTTAGG - Intergenic
1047023260 8:120799660-120799682 GAGTCCAATGTTCAGTTAATAGG + Intronic
1048109113 8:131447335-131447357 GAGCAGACTGTTCAGGCTTTTGG + Intergenic
1052141562 9:24991630-24991652 GAGCCTACTGTTCAGGAGATGGG + Intergenic
1055400205 9:75915306-75915328 GAGCAGCCTGTTCTGTTTATGGG + Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1185513607 X:681228-681250 GAGCCGGCTGCACAGTTTGTGGG + Intergenic
1190790106 X:53691120-53691142 GAGCTCACTGTTCAGTGTAGAGG - Intergenic