ID: 1057875838

View in Genome Browser
Species Human (GRCh38)
Location 9:98753985-98754007
Sequence CCCATCTCTTCCCAGTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057875830_1057875838 28 Left 1057875830 9:98753934-98753956 CCAGCTTGGGCATGTCCTATAAA 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1057875838 9:98753985-98754007 CCCATCTCTTCCCAGTGTCGTGG No data
1057875832_1057875838 13 Left 1057875832 9:98753949-98753971 CCTATAAACTGAACAGTCGGCTC 0: 1
1: 0
2: 2
3: 1
4: 44
Right 1057875838 9:98753985-98754007 CCCATCTCTTCCCAGTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057875838 Original CRISPR CCCATCTCTTCCCAGTGTCG TGG Intronic
No off target data available for this crispr