ID: 1057875840

View in Genome Browser
Species Human (GRCh38)
Location 9:98753994-98754016
Sequence TCCCAGTGTCGTGGTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057875835_1057875840 -7 Left 1057875835 9:98753978-98754000 CCCACTGCCCATCTCTTCCCAGT 0: 1
1: 0
2: 9
3: 51
4: 564
Right 1057875840 9:98753994-98754016 TCCCAGTGTCGTGGTCCAGCTGG No data
1057875834_1057875840 -6 Left 1057875834 9:98753977-98753999 CCCCACTGCCCATCTCTTCCCAG 0: 1
1: 0
2: 2
3: 91
4: 671
Right 1057875840 9:98753994-98754016 TCCCAGTGTCGTGGTCCAGCTGG No data
1057875836_1057875840 -8 Left 1057875836 9:98753979-98754001 CCACTGCCCATCTCTTCCCAGTG 0: 1
1: 0
2: 2
3: 62
4: 708
Right 1057875840 9:98753994-98754016 TCCCAGTGTCGTGGTCCAGCTGG No data
1057875832_1057875840 22 Left 1057875832 9:98753949-98753971 CCTATAAACTGAACAGTCGGCTC 0: 1
1: 0
2: 2
3: 1
4: 44
Right 1057875840 9:98753994-98754016 TCCCAGTGTCGTGGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057875840 Original CRISPR TCCCAGTGTCGTGGTCCAGC TGG Intronic
No off target data available for this crispr