ID: 1057877779

View in Genome Browser
Species Human (GRCh38)
Location 9:98771097-98771119
Sequence GCCGTGCAGGATCACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057877779 Original CRISPR GCCGTGCAGGATCACAGTGT GGG Intronic
903977413 1:27159894-27159916 GCCGTGGAGGATCTCAGGGCTGG - Intronic
905761105 1:40558958-40558980 GCCGTGCAGGAGCCCACTGCGGG + Intergenic
906491831 1:46274475-46274497 GCTGAGCAGGATCCCAGTTTAGG + Intronic
909471770 1:76037193-76037215 GCCACGGAGGATGACAGTGTGGG - Intergenic
910223784 1:84916242-84916264 GTCGTGCAGGGTCACTGTGCTGG + Intergenic
911935873 1:103971356-103971378 TCTGGGCAGGATGACAGTGTAGG - Intergenic
913171224 1:116234065-116234087 GCAGTCCACGATCACAGCGTGGG + Intergenic
913987134 1:143575339-143575361 GCCGTGCAGGAGCCCACTGTGGG - Intergenic
920788126 1:209062413-209062435 GCAGTGCAGGAGCACAGGGTGGG - Intergenic
922121969 1:222680127-222680149 GCAATGCAGGTTCACAGTGATGG + Intronic
922351955 1:224741612-224741634 GCTGTGCATGATCACTGTGAGGG - Intergenic
1064780471 10:18832416-18832438 GGAGTGCAGGGTCACAGTCTTGG + Intergenic
1065408907 10:25399505-25399527 GGCATGCAGGATGACAGTTTGGG - Intronic
1068570783 10:58626178-58626200 GCTGTGCAGCATTACATTGTTGG + Intronic
1073059767 10:100726419-100726441 GCCCTGCAGCCTCACAGTCTTGG + Intergenic
1073530669 10:104229321-104229343 GACGTGCAGCAGCTCAGTGTGGG + Intronic
1074053481 10:109900660-109900682 GCCTTGCAGGATCTCAGAGTTGG - Intronic
1074203723 10:111262152-111262174 GCAGTGCAGGATCATACTTTTGG + Intergenic
1075504961 10:123013578-123013600 GCCGTGCAGGAGCCCACTGGCGG + Intronic
1077759293 11:5073797-5073819 GATTTGCAGGATCTCAGTGTTGG - Intergenic
1083734097 11:64669858-64669880 GGCCTGCAGAAGCACAGTGTTGG - Intronic
1084676721 11:70639755-70639777 GCCCTGCAGGCCCACAGGGTGGG + Intronic
1090991781 11:131823955-131823977 GCTGTGTATGATTACAGTGTTGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093568980 12:20643983-20644005 GGGGGGCAGTATCACAGTGTTGG - Intronic
1100972429 12:100084526-100084548 GCTGTGAAGGATCATAATGTAGG - Exonic
1104198794 12:126567325-126567347 GCCGTGCAGGAGCCCACTGTGGG - Intergenic
1110950659 13:81485896-81485918 GAAGTTCAGGATCAAAGTGTGGG - Intergenic
1113500859 13:110772922-110772944 CCCCTGCAGGATTACAGTATTGG + Intergenic
1114063555 14:19040231-19040253 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1114098701 14:19359765-19359787 GCCCTGCAGTCTCACAGTGGAGG + Intergenic
1117372674 14:55093180-55093202 CACGTGCAGGATCATAGTGTGGG + Intergenic
1121191467 14:92034370-92034392 GGAGTGCAGTAGCACAGTGTCGG - Intronic
1122342278 14:101036146-101036168 GAAGTTCAGGAACACAGTGTGGG + Intergenic
1122577730 14:102752379-102752401 GCCATGCATGCTCACTGTGTTGG - Intergenic
1122891509 14:104734223-104734245 GCCCTGCAGGAGCAGAGGGTGGG + Intronic
1123138667 14:106054450-106054472 TCCATGGAGGATGACAGTGTAGG + Intergenic
1123708281 15:22966497-22966519 GACATCCAAGATCACAGTGTGGG - Intronic
1133215313 16:4288614-4288636 GCCGAGCAGGAACACGGTGGGGG + Intergenic
1134180898 16:12046906-12046928 ACCGTGCCCGACCACAGTGTTGG + Intronic
1142608512 17:1095515-1095537 GCCGTGCCGAAGCTCAGTGTGGG - Intronic
1142619541 17:1156087-1156109 CCCATTGAGGATCACAGTGTTGG - Intronic
1142828775 17:2532207-2532229 GCCGCGCAGGAGCCCAGCGTGGG + Intergenic
1144101446 17:11945485-11945507 GGAGTGCAGTGTCACAGTGTCGG - Intronic
1146852541 17:36235603-36235625 GGAGTGCAGGTTCACAGTCTGGG - Intronic
1146868454 17:36359475-36359497 GGAGTGCAGGTTCACAGTCTGGG - Intronic
1147071326 17:37960099-37960121 GGAGTGCAGGTTCACAGTCTGGG - Intergenic
1147082853 17:38039625-38039647 GGAGTGCAGGTTCACAGTCTGGG - Intronic
1147098796 17:38163596-38163618 GGAGTGCAGGTTCACAGTCTGGG - Intergenic
1147953952 17:44122292-44122314 GCCTTGCAGGATTGCAGTCTGGG - Intronic
1149838836 17:59939781-59939803 GGAGTGCAGGTTCACAGTCTGGG + Intronic
1150080329 17:62232638-62232660 GGAGTGCAGGTTCACAGTCTGGG - Intergenic
1152861553 17:82699090-82699112 GCGGTGCAGGGTCCCAGCGTGGG + Intergenic
1152987146 18:331256-331278 TCCCTTCAGGATCACACTGTGGG - Intronic
1153766636 18:8380924-8380946 GTCATGCAGGGTGACAGTGTCGG + Intronic
1157803208 18:50637715-50637737 GAAGTCCAAGATCACAGTGTTGG + Intronic
1158783980 18:60686381-60686403 GCCGGGCAAGATCTCAGTGATGG + Intergenic
1162346972 19:10124624-10124646 GAAGTCCAAGATCACAGTGTCGG + Intergenic
1167149623 19:47701463-47701485 GCCGTGCCGGATCACAAGCTTGG - Exonic
925130904 2:1493451-1493473 GCCGGGCAGTGTCACAGGGTGGG + Intronic
925130934 2:1493595-1493617 GCCGGGCAGTGTCACAGGGTGGG + Intronic
927430702 2:23024264-23024286 GCCATGCAACATCCCAGTGTAGG + Intergenic
927719908 2:25375977-25375999 GCCGTGCAGCACCACAGCCTGGG - Intergenic
928837004 2:35559235-35559257 GCAGTGCAGAAGCAAAGTGTGGG + Intergenic
929931995 2:46264607-46264629 GCAGTGCAGGATCCCGGTGGAGG + Intergenic
936000480 2:108823561-108823583 GCTGTACAGGATCACAGCCTAGG - Intronic
942669698 2:178361750-178361772 TCCGAGCAGGATCACAGTAAAGG + Exonic
943651391 2:190461552-190461574 GAAGTGCAAGATCAAAGTGTTGG + Intronic
947103837 2:226648297-226648319 GCCGTGCAGGAGCCCATGGTGGG - Intergenic
1170728368 20:18949480-18949502 GCCGTCCAAGATCAAGGTGTGGG + Intergenic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1175447512 20:59033037-59033059 GCAGTGAAGGCTCACAGTCTAGG + Intergenic
1175671916 20:60910640-60910662 GAAGTCCAGGATCAAAGTGTAGG + Intergenic
1176164687 20:63666584-63666606 GCAGTGCAGTGTCACAGTCTTGG + Intronic
1180482049 22:15762865-15762887 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1182542558 22:31052237-31052259 GCAGTGCAGTAGCACAGTCTCGG - Intergenic
950264676 3:11564923-11564945 GCCGTGCAGGCTCATGGTGGGGG + Exonic
950872069 3:16238031-16238053 GCCGTACTGAATAACAGTGTAGG - Intergenic
953714659 3:45306973-45306995 GCCGCGCAGGAGCCCAGGGTGGG - Intergenic
955144893 3:56307353-56307375 GCAGTGCACAATTACAGTGTAGG + Intronic
955159151 3:56447210-56447232 CCCTTGCAGGACCACAGAGTGGG + Intronic
961298258 3:125904177-125904199 GCCTTGCAGGATCCCACAGTGGG - Intergenic
962177201 3:133167472-133167494 GCCGTGCAGGAGCCCACCGTGGG + Intronic
963628099 3:147698638-147698660 GCAGTGCAGTAGCACAGTCTCGG + Intergenic
964982467 3:162702995-162703017 GCCGTGCAGGAGCCCACTGCAGG + Intergenic
967016864 3:185490089-185490111 GGGGTGCAGGATCACAGGGCTGG + Exonic
967234067 3:187367651-187367673 GCCATGCAGGAGCCCAGGGTGGG + Intergenic
968608721 4:1547293-1547315 GCAGTGCAGGGCCTCAGTGTGGG + Intergenic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
971590243 4:28458297-28458319 GCTCTGCAGGATCCCAGTGCTGG - Intergenic
975844409 4:78509715-78509737 GATGTGCAGGATCACTGTGGTGG - Intronic
977495867 4:97774728-97774750 GCAGTATAGGATCATAGTGTTGG + Intronic
978630505 4:110738544-110738566 GCAGTCCAAGATCAAAGTGTTGG - Intergenic
981272155 4:142857672-142857694 GCCATCCAGGACCACAGTCTTGG + Intergenic
982267423 4:153551406-153551428 GGAGTGCAGGGGCACAGTGTCGG + Intronic
982841631 4:160195000-160195022 GCTGTCCAGGATTTCAGTGTGGG + Intergenic
985835610 5:2269898-2269920 GACGTCCAGGATCAGGGTGTGGG + Intergenic
986304327 5:6504345-6504367 GAAGTCCAAGATCACAGTGTTGG + Intergenic
986358273 5:6949999-6950021 GCCGTGAAGGATAACAGGGAGGG - Intergenic
987523563 5:19019232-19019254 GAATTGCAGGATCACTGTGTTGG - Intergenic
987707909 5:21478854-21478876 GAAGTGCAAGATCAAAGTGTTGG + Intergenic
988625739 5:32872591-32872613 GAAGTGCAAGATCAAAGTGTTGG + Intergenic
988751873 5:34196083-34196105 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
989066430 5:37467286-37467308 GAAGTGCAAGATCAAAGTGTTGG + Intronic
989450662 5:41582926-41582948 GGAGTGCAGCATCACAGTCTTGG - Intergenic
990324335 5:54660197-54660219 GAAGTCCAAGATCACAGTGTTGG + Intergenic
991737202 5:69638868-69638890 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991739639 5:69656900-69656922 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991757863 5:69896277-69896299 GAAGTGCAAGATCAAAGTGTTGG + Intergenic
991788776 5:70218594-70218616 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991791214 5:70236641-70236663 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991813527 5:70493700-70493722 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991816659 5:70514983-70515005 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991819099 5:70533024-70533046 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991837266 5:70772159-70772181 GAAGTGCAAGATCAAAGTGTTGG + Intergenic
991881223 5:71218958-71218980 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
991883660 5:71236982-71237004 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
994419976 5:99519832-99519854 GAAGTGCAAGATCAAAGTGTTGG + Intergenic
994487233 5:100395310-100395332 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
994499841 5:100560905-100560927 TCCTTGCAGGGTCACAGTTTTGG + Intronic
995379205 5:111512878-111512900 GAAGTGAAGGATCACAGTGAGGG + Intergenic
996286184 5:121795753-121795775 GACCTGCAGGAGCACAGTGGGGG + Intergenic
998336347 5:141375609-141375631 GGCGTACAGAATCCCAGTGTCGG - Exonic
1000573420 5:162944291-162944313 GTCATGAAGAATCACAGTGTTGG - Intergenic
1002174110 5:177391681-177391703 CCCGTTCAGGATCACATGGTTGG - Intronic
1004237710 6:13889251-13889273 GAAGTGCAGGATCAAGGTGTGGG + Intergenic
1004814955 6:19302847-19302869 TCTGGGCAGTATCACAGTGTGGG - Intergenic
1005550036 6:26902786-26902808 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
1008230958 6:48984282-48984304 GGAGTGCAGGCACACAGTGTGGG + Intergenic
1009020298 6:57941685-57941707 GAAGTGCAAGATCAAAGTGTTGG - Intergenic
1011613700 6:89179013-89179035 GCCGTCCAGCATCGCAGTGCGGG + Exonic
1013004052 6:106054002-106054024 GCAGAGCAGGATCATTGTGTTGG + Intergenic
1013078557 6:106792286-106792308 ACATTGCAGGATCACAGTTTAGG + Intergenic
1015105453 6:129531190-129531212 GCAGTGCAGGATCCAAGTGCTGG + Intergenic
1017594880 6:156017649-156017671 GCCCTGCAGGAGCCCACTGTTGG + Intergenic
1019286588 7:226317-226339 GCCCTGGAGGGTCACAGTGCAGG + Intronic
1019630007 7:2043906-2043928 ACCGTGCAGGAACAGGGTGTGGG + Intronic
1021606545 7:22414594-22414616 GCTGGGCAGGAACACAGTGTGGG - Intergenic
1024229311 7:47352403-47352425 GCCGTGTTGGAGCACAGGGTGGG - Intronic
1036171517 8:6489983-6490005 GCCTTCAAGGATCACACTGTTGG + Intronic
1036519098 8:9474029-9474051 ACCGTGAAGCACCACAGTGTGGG + Intergenic
1038208734 8:25494966-25494988 GCAGTGCAAGATCAGGGTGTTGG - Intronic
1038395450 8:27242655-27242677 GCTGTTCAGGATCCCTGTGTGGG + Intronic
1040896213 8:52371152-52371174 GCAGTGGTGGAGCACAGTGTTGG - Intronic
1046832853 8:118765340-118765362 GCCCTGCAGGATTTCCGTGTGGG - Intergenic
1049046530 8:140156383-140156405 GCCTCGCAGGATCCCCGTGTGGG - Intronic
1049200391 8:141337208-141337230 TCCCTGCAGGATGACAGGGTGGG - Intergenic
1051095563 9:13461795-13461817 TCCTGGCAGGATCACAGTGTTGG + Intergenic
1051314113 9:15810381-15810403 GGAGTGCAGGCACACAGTGTGGG - Intronic
1056002109 9:82228192-82228214 GCCGAGCAGCATCAGTGTGTGGG - Intergenic
1057877779 9:98771097-98771119 GCCGTGCAGGATCACAGTGTGGG + Intronic
1061696828 9:132382171-132382193 GCAGTGAAGGCTCACAGTGAAGG + Intronic
1061891763 9:133625406-133625428 GCCCTGCAGAATCACAGGGATGG - Intergenic
1188404648 X:29792405-29792427 GAAGTTCAAGATCACAGTGTTGG + Intronic
1197353448 X:125404684-125404706 GCTGTGCAGGGTTACAGTGGGGG + Intergenic
1201617795 Y:15920946-15920968 GTGTTGCAGGATCACAGTGAAGG - Intergenic