ID: 1057878858

View in Genome Browser
Species Human (GRCh38)
Location 9:98778144-98778166
Sequence AACCCAGGAGGTAGGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057878847_1057878858 15 Left 1057878847 9:98778106-98778128 CCAGTGTCCCATTCCAACATCAT 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242
1057878850_1057878858 2 Left 1057878850 9:98778119-98778141 CCAACATCATCTTACCCCTGACA 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242
1057878848_1057878858 8 Left 1057878848 9:98778113-98778135 CCCATTCCAACATCATCTTACCC 0: 1
1: 1
2: 0
3: 14
4: 197
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242
1057878845_1057878858 29 Left 1057878845 9:98778092-98778114 CCAGCCTCTATGCTCCAGTGTCC 0: 1
1: 0
2: 1
3: 22
4: 261
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242
1057878846_1057878858 25 Left 1057878846 9:98778096-98778118 CCTCTATGCTCCAGTGTCCCATT 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242
1057878849_1057878858 7 Left 1057878849 9:98778114-98778136 CCATTCCAACATCATCTTACCCC 0: 1
1: 0
2: 4
3: 21
4: 233
Right 1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057878858 Original CRISPR AACCCAGGAGGTAGGATGAA GGG Intronic
902261666 1:15229845-15229867 TACCCAGGAAGTAGGAGCAAGGG - Intergenic
903384738 1:22918957-22918979 ATCCCAGGAGGTGGGAAGGAAGG - Intergenic
903386391 1:22929870-22929892 GACACAGGAGGTAGGATAGATGG + Intergenic
906875160 1:49529599-49529621 AACCCAGGAGGCAGAGTGCAGGG + Intronic
907264467 1:53248883-53248905 AACTCAGGAGGCAGGTAGAATGG + Intronic
908727957 1:67197130-67197152 AACCCAGGTGGAAGGCTGGAGGG + Intronic
910089229 1:83442344-83442366 AACCCAGTAGCTGGGATGATGGG - Intergenic
910118764 1:83761300-83761322 AAGCCAGGAGGAAGCAAGAAAGG + Intergenic
910179259 1:84463453-84463475 AACGCAGTAGGGAGGAGGAAAGG - Intergenic
911058352 1:93726968-93726990 AACCCAAGAGAAAAGATGAAAGG - Intronic
911104230 1:94117497-94117519 AACCCAGAAGCTGGGATGAAGGG + Intronic
912556644 1:110520979-110521001 AACCTAGGAGGCAGGGAGAAGGG - Intergenic
913181595 1:116327749-116327771 AACCCAGGAGAAAAGATGAATGG + Intergenic
915239214 1:154507886-154507908 AATGCAGGAGGGAGGCTGAAGGG - Intronic
915725883 1:158017213-158017235 AACGCAGGAGGAAGCAGGAAAGG - Intronic
916161187 1:161916649-161916671 AACCAAAGAGGTATGATGAGTGG - Intronic
916253226 1:162759115-162759137 GACCCAGGAAGTAAGATGCAAGG - Intronic
920122119 1:203666530-203666552 AACCTAGGAGGCACGAAGAACGG - Intronic
922166747 1:223122087-223122109 AACCTTGGAGGTAGGAGGGATGG - Intronic
922998485 1:229985606-229985628 CGCACAGGAGGTAGGATGATAGG - Intergenic
923320829 1:232831217-232831239 ACACCAGGTGTTAGGATGAATGG + Intergenic
924312346 1:242757193-242757215 AACCCAGGAGGGACCATCAAGGG - Intergenic
924379408 1:243448059-243448081 AACCCATGAGTTAGGAAGCAAGG - Intronic
1063953154 10:11242834-11242856 TCCCCAGGAGGTGGGACGAAGGG + Intronic
1064007323 10:11709096-11709118 TGCCCAGTAGGTATGATGAAAGG + Intergenic
1064413188 10:15126045-15126067 ACCCCAGGAGGTGGGATCACTGG - Intronic
1065268060 10:23997954-23997976 AAGCCAGGAGGTATGGAGAAGGG + Intronic
1065754909 10:28922266-28922288 AATCCAGGAGGGAGGGTGAGAGG - Intergenic
1066373839 10:34839647-34839669 AACTCAGGAAAGAGGATGAATGG - Intergenic
1066658425 10:37716695-37716717 AACCCAGGGAGCAGGCTGAAAGG - Intergenic
1069221997 10:65895231-65895253 AGCCCAAGAGGAAAGATGAAAGG - Intergenic
1069801996 10:71087486-71087508 AAGCCAGGAGCTAGGATGGTGGG + Intergenic
1069956883 10:72057403-72057425 CTCCCAGCATGTAGGATGAAAGG - Intergenic
1072125833 10:92444538-92444560 GAACCAGGACATAGGATGAAAGG - Intergenic
1074223396 10:111460395-111460417 ATCCCAGCAGGAAGGATGAGAGG - Intergenic
1074293927 10:112165151-112165173 AAGCCAGGAAGTAGAATAAAAGG + Intronic
1074356987 10:112795023-112795045 AACCCATGAGATAGGAAAAAAGG + Intronic
1074898363 10:117796079-117796101 AAGACAGGAGGAAGGATGGATGG - Intergenic
1076982740 11:213488-213510 GCCCCAGGAGGTAGGATCAGAGG + Intronic
1077215435 11:1393498-1393520 AACGAAGGAGCTAGGATGAGGGG + Intronic
1077469261 11:2749191-2749213 ACCCCAGTAGGGAGGATGAGAGG + Intronic
1079283512 11:19108864-19108886 AACCTCGGAGGAAGGAGGAAGGG - Intergenic
1079525742 11:21385530-21385552 ATACTAGGAGGTAGGATGGAGGG - Intronic
1079644726 11:22849413-22849435 AAACCAGTTGGTGGGATGAATGG + Intronic
1080671530 11:34383851-34383873 AAGCAAGGAGGGAGGAAGAAGGG - Intergenic
1081772217 11:45657056-45657078 AACTCAGGAGCCATGATGAATGG + Intronic
1082944268 11:58741273-58741295 AACCTAGGAGGTGGGATTATGGG - Intergenic
1083180456 11:60981793-60981815 AGGCCAGGAGGCAGGATGCAGGG + Intronic
1083420147 11:62547723-62547745 CACCTAGGAGGGAGGATAAAAGG - Intronic
1084380864 11:68811928-68811950 AACCCTAGAGGTAGGAGGGACGG + Intronic
1084450302 11:69232872-69232894 GACCCAGGTGGGAGGATGGAGGG + Intergenic
1085451964 11:76639552-76639574 ATCCCAGGAGGCAGGAGTAAGGG + Intergenic
1085608816 11:77927925-77927947 GACACTGGTGGTAGGATGAAAGG - Intronic
1086817372 11:91389718-91389740 AAGCCAGGTGTTAGGATGGATGG + Intergenic
1087152524 11:94871445-94871467 AACTCAGAAGTTAGGATGGATGG - Exonic
1087411966 11:97802792-97802814 AGCTCAGGAGGGAGGAAGAATGG + Intergenic
1088672020 11:112151045-112151067 AACCCAGGAGGTAGAATTGCTGG - Intronic
1088907299 11:114164472-114164494 AACCCAGAACGTAGGAAGGATGG - Intronic
1089423204 11:118347726-118347748 TACTCAGGAGGTGGGAGGAATGG - Intronic
1089752661 11:120662427-120662449 AACCAAGGAGACAGGAAGAACGG - Intronic
1092463043 12:8703206-8703228 AACCCAGGAGGCAGGTTGCAGGG + Intronic
1092712302 12:11352041-11352063 AACACAGGAGGTAGAAGGGATGG - Intronic
1093645379 12:21580145-21580167 AACCGAGGAGGAAGGATAATTGG - Intronic
1093941231 12:25056975-25056997 AACACAGGAGGGAGTATGATTGG - Intronic
1096189933 12:49609837-49609859 GTCCCAGGAGGTAAGATGAGTGG - Intronic
1096685267 12:53284330-53284352 AACCTAGGAGGCAGGAGGCAGGG - Intronic
1097218730 12:57434315-57434337 ACCCCAGGAGGGAGGATGGAGGG + Intergenic
1097591931 12:61585253-61585275 ATACCAGGAGGTAGGATGTAGGG + Intergenic
1098413560 12:70207451-70207473 GAGCTAGGAGGTAGGAGGAATGG - Intergenic
1100213023 12:92417709-92417731 AACCTAGGAGATTAGATGAATGG + Intergenic
1101371119 12:104131836-104131858 AACCTGGGAGGCAGGGTGAAGGG + Intronic
1104542352 12:129677780-129677802 AAGCCAGTAAGGAGGATGAAGGG - Intronic
1105957295 13:25295903-25295925 AGCCCCAGAGGTTGGATGAAGGG - Intergenic
1106461747 13:29976644-29976666 ACCCAAGGAGCTAGGCTGAAGGG + Intergenic
1107800836 13:44106754-44106776 AACACAGGAGGTAGGAGGGTGGG - Intergenic
1109691192 13:65892024-65892046 AACACAGGAGGAAAGAGGAAGGG + Intergenic
1110252091 13:73391751-73391773 CACCCAGGGAGAAGGATGAAGGG + Intergenic
1111002633 13:82205458-82205480 AGCACAGGAGGGAGGATGAGGGG + Intergenic
1111358473 13:87142239-87142261 AACCTAGGTGGTAGGTTGACAGG + Intergenic
1112468736 13:99668803-99668825 AATCCAGAAAATAGGATGAAGGG + Intronic
1112879657 13:104090662-104090684 AACCTAGGAGTTAGGCTTAAAGG + Intergenic
1113303232 13:109045889-109045911 CACCCATGAGGTAGTATGGATGG - Intronic
1113954423 13:114089555-114089577 GACCCAGGAAGCAGGAGGAAAGG + Intronic
1115935493 14:38547742-38547764 ACCTCAGGAAGTAGGAGGAAGGG - Intergenic
1116086227 14:40241669-40241691 ACCTGAGGAGGTGGGATGAATGG + Intergenic
1116574331 14:46553358-46553380 AACCTTGGTGGAAGGATGAAGGG - Intergenic
1116770389 14:49120686-49120708 AATCCAGGAGGCAGGATTATGGG - Intergenic
1119769529 14:77211774-77211796 AACCCAGGATGGAGGAGAAATGG + Intronic
1121066964 14:90976666-90976688 CACACAGGAGGCAGAATGAAGGG + Intronic
1122641452 14:103162111-103162133 AACACGTGAGGCAGGATGAATGG - Intergenic
1125083047 15:35697984-35698006 ATCCCAGGTGGTATGATGACAGG - Intergenic
1126406369 15:48327007-48327029 AATAGAGGAGGTAGGAAGAAGGG - Intergenic
1127210578 15:56770628-56770650 TAGCCAGAAGGTAAGATGAAAGG - Intronic
1127833421 15:62770606-62770628 AACTCAGGAGGAAGGAGGAGTGG - Intronic
1128249040 15:66152053-66152075 AACCCAGGAAGTAGGAGGAGAGG - Intronic
1129104298 15:73295439-73295461 AACCCAGGAGGAAGGAGGAAGGG - Intronic
1130527201 15:84717255-84717277 AAACCAGGAGGTAGAATTCAAGG - Intergenic
1131197980 15:90372212-90372234 AACCCAAGATGTAGAAAGAAAGG - Intergenic
1131438467 15:92441113-92441135 CACAGAGGAGGTAGGGTGAATGG - Intronic
1131975008 15:97935607-97935629 AACCCAGACAGAAGGATGAAAGG + Intergenic
1133393364 16:5427018-5427040 AACAGAGGAGGTGGCATGAAAGG - Intergenic
1138263529 16:55643284-55643306 AGCCCAGGAGGCAGGTGGAACGG - Intergenic
1138656753 16:58495903-58495925 AGCCCAGGAGGTGGGATGGGAGG + Intronic
1138897330 16:61222616-61222638 AAACCAGAAGGTAGAAGGAAAGG - Intergenic
1140412560 16:74749656-74749678 AACCCAGGACGTAGGAAAAGGGG + Intronic
1140594837 16:76396405-76396427 TATCAAGGAGGTAGGAAGAATGG + Intronic
1142081798 16:88153195-88153217 AACCCAGGTGGGGGGCTGAATGG + Intergenic
1142598630 17:1041874-1041896 GACCCAGGAAGAAGGGTGAAGGG + Intronic
1142605730 17:1080095-1080117 AACCCATGAGGTAGGAAGGAAGG + Intronic
1143301481 17:5913804-5913826 ATCACTGGAGGTTGGATGAATGG - Intronic
1144657299 17:17044923-17044945 ATCCCAGGAGGTAGAATGCTGGG - Intronic
1145109122 17:20146207-20146229 CACTTAGGAGGAAGGATGAACGG - Intronic
1145256906 17:21330447-21330469 AACCCAAAAGGCAGAATGAAGGG + Intergenic
1148131191 17:45263519-45263541 AAGCCAGGAGATGGGGTGAAGGG - Exonic
1149326359 17:55534382-55534404 TACCCAGGGGGTAGAATGGAGGG + Intergenic
1150373491 17:64661852-64661874 AACCCCGGAGGCCGGAGGAACGG - Exonic
1152590401 17:81208817-81208839 GACCCAGGAGGCTGGAGGAAGGG + Intronic
1153053824 18:926183-926205 AAGCCAGGAAGTGGGATTAAAGG - Intergenic
1157710769 18:49848271-49848293 CACGGAGGAGGTGGGATGAAGGG + Intronic
1159163340 18:64672402-64672424 AACCCGGGAGGTAGGTTGCAGGG - Intergenic
1160506699 18:79431296-79431318 AGCCCAGGAGGCAGCTTGAATGG - Intronic
1160603458 18:80032252-80032274 AAACCAGCAGGTGGGAAGAAAGG + Intronic
1161616036 19:5270766-5270788 AATCCGGGAGCTAGGATGACAGG + Intronic
1161894850 19:7072726-7072748 AACCCAGGATCTGGGAAGAAGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163462606 19:17448130-17448152 GCCCCAGGAGGTAGGAGGACTGG - Exonic
1167356037 19:49004709-49004731 AACCCAGGCAGCAGGAAGAAAGG + Intronic
1168443025 19:56388165-56388187 AACCCAGGAGCCAGTTTGAAAGG + Intronic
926033949 2:9619318-9619340 AACTCAGCAGGTAGGATTTAAGG - Intronic
927715234 2:25347594-25347616 AAGTCAGGAGGGAGGATGGAAGG - Intergenic
927989169 2:27435275-27435297 AACCATGGGGGTAAGATGAAAGG + Intronic
928360711 2:30660083-30660105 AACCGTGGAGGCAGGGTGAAGGG + Intergenic
929587650 2:43126527-43126549 AGCCCAGGATGTGGGATGACTGG + Intergenic
929610990 2:43270504-43270526 AACCCAGGAGTTAAGAGAAAGGG - Intronic
929884649 2:45867860-45867882 AAGTGATGAGGTAGGATGAAAGG - Intronic
930755523 2:54968445-54968467 AAGCCAGAAGGGAGGATGGAGGG + Intronic
931813146 2:65874281-65874303 GATCCAGGAGAAAGGATGAATGG + Intergenic
932125023 2:69137429-69137451 AACCCAGGAGGTGGCATAAATGG - Intronic
932212348 2:69943164-69943186 AAACCAGTAGGTGGGATGATGGG - Intergenic
932285006 2:70524690-70524712 AGTCCAGGAGGGAGGAAGAAGGG + Intronic
934537799 2:95150692-95150714 AAACCTGGAGGTAGGAAGACTGG - Intronic
934783220 2:96986254-96986276 AACTCAGGAGGCAGGATCAGCGG - Exonic
935401905 2:102668815-102668837 AAGACAGAAGGAAGGATGAATGG - Intronic
936166436 2:110124141-110124163 CACCTAAGAGGTAGGATGGAGGG + Intronic
937937123 2:127255304-127255326 AAGACAGGAAGTGGGATGAAGGG + Intergenic
938001533 2:127743791-127743813 AAACGAGGAGGTAGGAGGCATGG + Intronic
940130723 2:150378519-150378541 AACCCTGGAGGTAATTTGAAAGG - Intergenic
942558873 2:177199647-177199669 GAGCCAGGAGGTAGGAATAAGGG - Intergenic
945552868 2:211242546-211242568 AATCAAGAAGGTAGGAAGAACGG - Intergenic
946438439 2:219675053-219675075 GACCCAGGATGTAGGAGAAAAGG - Intergenic
947742148 2:232489574-232489596 GACCCGGGAGGGAGGAGGAAGGG - Intergenic
1171235679 20:23522572-23522594 AGCCCAGAAGGTAGCTTGAAGGG + Intergenic
1171966440 20:31534338-31534360 AACCAAGCAGGTAGGGAGAAGGG + Intronic
1172124849 20:32619440-32619462 AATCCAGGTGTTAGGATGGACGG + Intergenic
1172484663 20:35291110-35291132 AACCAAGGAGGAAGGAGGAGAGG - Intronic
1172487111 20:35304969-35304991 AACCCAGGAGGTGGGCAGAGGGG - Intronic
1173092151 20:39983301-39983323 AACCCATTAGGTGGGAAGAAGGG + Intergenic
1173289074 20:41698636-41698658 AAACCAGGAGGCAGGATCATTGG - Intergenic
1174121339 20:48268038-48268060 AACCCATGAGGCGGCATGAAGGG - Intergenic
1176119443 20:63447411-63447433 AACCCGGGAGGAAGGAGAAACGG - Intronic
1179128544 21:38613941-38613963 AACTCAGAAGGTGGGATGCAAGG - Intronic
1181133267 22:20746902-20746924 TACCCAGGAGGAAGGGTGACAGG - Intronic
1182005563 22:26956622-26956644 AGCCCAGGAAGCAGGAAGAAGGG - Intergenic
1182414869 22:30214941-30214963 AAGCCAGGAGCTAGGAGGCAGGG + Intergenic
1182672165 22:32005524-32005546 AACACAGGAGAGAGGAAGAAAGG + Intergenic
1184082620 22:42234491-42234513 AACACAGGAGTTAGGAGGAGCGG + Intronic
1185306249 22:50118691-50118713 GACCCATGAGGTAGCATGAAGGG - Intronic
950575500 3:13829890-13829912 AAGGCAGGAGAAAGGATGAAGGG - Intronic
951107926 3:18767590-18767612 TACCCAGGAAGTTGGATGTAAGG - Intergenic
951187206 3:19727605-19727627 AACCCATGATGTAGGTTAAAAGG - Intergenic
953316878 3:41936181-41936203 AAGCAAGCAGGTAAGATGAAAGG + Intronic
953532153 3:43748500-43748522 AAGCCAGGATGGAGGAGGAAAGG - Intergenic
953577227 3:44122774-44122796 AACCCAGGTGGCAAGATGGAAGG + Intergenic
954920841 3:54189514-54189536 AGCCCAGGAGGTAGGACGGCAGG + Intronic
956821399 3:72957489-72957511 TACCCAGGGGGGCGGATGAAAGG - Intronic
959366258 3:105461712-105461734 AAACCAGGAGTTAGGAGAAATGG - Intronic
960265022 3:115611373-115611395 AAAACAGGAGGGAGGAAGAAAGG - Intergenic
961126466 3:124422989-124423011 AACCCAGGCTGAAGGAAGAAGGG - Intronic
961797516 3:129420302-129420324 ACCCCAGGAGGTAGGAACAATGG + Intronic
964336617 3:155661389-155661411 AACCCAGGAGGGAGTCTCAAAGG + Intronic
966585213 3:181615980-181616002 TACACAGGAGTTAGGATGCAAGG - Intergenic
966668710 3:182502305-182502327 AACTTAGCAGGTAGGATGGAAGG + Intergenic
968137784 3:196231539-196231561 CACATAGGAGGTAGAATGAAAGG + Intronic
969073753 4:4560843-4560865 AAGGGAGGAGGAAGGATGAAAGG - Intergenic
969177557 4:5410434-5410456 AGACCAAGAGTTAGGATGAAAGG - Intronic
969717933 4:8877439-8877461 AAAAGAGGAGGTAGGAAGAAGGG + Intergenic
971762435 4:30783995-30784017 AATCCAGGAGAAAGGTTGAAAGG + Intronic
972323315 4:37992404-37992426 AAACAAGGAAGTAGGAAGAAAGG + Intronic
972961748 4:44461475-44461497 AACCCAGCAGGAAGGAAGCAAGG + Intergenic
973899007 4:55447508-55447530 AACACAGAAGGTAGGATAACAGG + Intronic
976694487 4:87904472-87904494 AACCCAAGAGGCAAGAGGAATGG + Intergenic
980533692 4:134087789-134087811 AGGCCAGGAGGAAGGAAGAAGGG - Intergenic
981675584 4:147339406-147339428 AGACCAGGAGGTAGGATCAAAGG + Intergenic
984933180 4:184866673-184866695 AAACCAGCAGGCAGGAAGAAGGG + Intergenic
986420804 5:7579519-7579541 ATCCCAGGAGGACGGATGAGAGG + Intronic
996607240 5:125337924-125337946 AACCCAGGTGATAGGTTGATAGG - Intergenic
1001812263 5:174637910-174637932 AACCCAGGAGGCAGAATGAGTGG - Intergenic
1003599920 6:7507526-7507548 AACCCATGATGATGGATGAATGG + Intergenic
1005796916 6:29374056-29374078 AACTAAGGAGGTAGGAAGTATGG - Exonic
1005988115 6:30886569-30886591 ACCCCAGGAGGTAGGAGGAGTGG - Intronic
1006506375 6:34491370-34491392 AACCCAGCAGGTAGCAGGGAAGG - Intronic
1012199538 6:96388445-96388467 AACCCAGGGAGGAGGAGGAAAGG + Intergenic
1012379566 6:98604062-98604084 CACCCAGGAGTCAGGAGGAAAGG + Intergenic
1013252768 6:108350775-108350797 AAACCAGGAGGCAGCAGGAAAGG - Intronic
1013426841 6:110019657-110019679 AACTCAGGAGGGAGGATGGGAGG + Intergenic
1013940225 6:115652239-115652261 GACCCGTGAGGTAGCATGAATGG + Intergenic
1014124432 6:117760122-117760144 AGCCCAGGATGGAGGATGGAGGG - Intergenic
1017743522 6:157427173-157427195 AGCACAGGAGGAAGGAGGAAGGG + Intronic
1017755462 6:157525654-157525676 AAACCAGGAGGAGGGATCAATGG + Intronic
1018278362 6:162157280-162157302 AAGCCAGGAGCTAGCATGGAAGG - Intronic
1020180188 7:5916309-5916331 AAACCAGGGGGAAGGAAGAATGG + Intronic
1020302744 7:6808573-6808595 AAACCAGGGGGAAGGAAGAATGG - Intronic
1023835771 7:44066350-44066372 AACCCACAACGTAGGCTGAAGGG + Intronic
1024594381 7:50919540-50919562 AACCCTGATGGTAGGATGAAGGG - Intergenic
1025741011 7:64195593-64195615 AACCGAGTAGCTAGGATTAAAGG - Intronic
1025844087 7:65179886-65179908 GACACCGGTGGTAGGATGAAAGG + Intergenic
1025894415 7:65686195-65686217 GACACTGGTGGTAGGATGAAAGG + Intergenic
1026580540 7:71612775-71612797 AAACTAGGAGCTTGGATGAAAGG - Intronic
1027306085 7:76898782-76898804 AACCCAGTAGCTGGGATGACGGG - Intergenic
1027991174 7:85362269-85362291 AACCCAGAAACAAGGATGAATGG - Intergenic
1030060258 7:105615921-105615943 ACCCCAGGCTGTAGGATGGAAGG - Intronic
1031426503 7:121611706-121611728 AACCAAAGAGGTGGGATGAAAGG + Intergenic
1032701419 7:134383167-134383189 TACCCAAGAGGTAGGCTGTATGG - Intergenic
1034517808 7:151594228-151594250 CTCCCAGGAGGAAGCATGAAGGG - Intronic
1035898863 8:3435671-3435693 AAGGCAGGAGGTAGGACGGAAGG - Intronic
1036726495 8:11225341-11225363 GACCCAGGAGGTGGGAAGACAGG - Intergenic
1039174860 8:34792396-34792418 AACCCAGGTTGTAGGATGCCAGG - Intergenic
1040889442 8:52301803-52301825 AAAAAAGGAGGAAGGATGAAAGG - Intronic
1041129358 8:54681114-54681136 AACCCAGGGAATAGGATGAAGGG - Intergenic
1041692808 8:60705211-60705233 AAACAAGGAGGCAGGAGGAATGG + Intronic
1043261859 8:78210381-78210403 AAACTAGGAGGTATGCTGAAAGG - Intergenic
1044063106 8:87663809-87663831 ACCCCAGAAGGTATGATGATGGG - Intergenic
1044503116 8:92985368-92985390 AATCCAGGAGCTAGGAGGAATGG - Intronic
1044576164 8:93771373-93771395 AACACAGGAGCTATGCTGAAAGG - Intronic
1045019385 8:98028486-98028508 AACCCAAAAGGTAGGATAATTGG + Intronic
1046059421 8:109118884-109118906 ATCCCAGGAAGCAGGATTAAGGG - Intronic
1047348717 8:124053231-124053253 ACCTCAGGAGGGAGGATGAGAGG - Intronic
1047771747 8:128035471-128035493 AACGCAGAAGGAGGGATGAAGGG - Intergenic
1049920208 9:356125-356147 AACCCAGGATGTGGTTTGAAGGG - Intronic
1050433433 9:5585115-5585137 AACCAAAGAGGTAGAATGAAAGG + Intergenic
1051516439 9:17935257-17935279 AACCCATAAGGCAGGAGGAAAGG - Intergenic
1052280185 9:26723929-26723951 AACCTAGGAGCTTGGAGGAAAGG - Intergenic
1052466849 9:28839915-28839937 AGCACAGGAGGGAGGATGAGGGG - Intergenic
1052609921 9:30758985-30759007 AACACAGGAGGGAGGCTGAAGGG - Intergenic
1053278827 9:36803242-36803264 AACTAAGGAGGTAGAAAGAAAGG + Intergenic
1055181684 9:73395868-73395890 GACTCAGCAGGAAGGATGAAGGG - Intergenic
1055591057 9:77814240-77814262 AGCCCAGGAGGAAGGAACAAAGG + Intronic
1056077547 9:83057082-83057104 GGCCCAGGAGGAAGGATCAAAGG + Intronic
1056188419 9:84160605-84160627 AACCCATGAGGGAGGAGGGAAGG - Intergenic
1056214441 9:84394075-84394097 ATCCCAGGAGGTGGGGTGAGTGG + Intergenic
1057186863 9:93061982-93062004 ATCCCAGGAGGGAGGATGGAGGG + Intronic
1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG + Intronic
1059833244 9:118122181-118122203 AAGACAGGAGGGAGGATGCATGG + Intergenic
1062023980 9:134332091-134332113 AACCCTGGAGTGAGGATCAAGGG - Intronic
1062383975 9:136301385-136301407 GAGACAGGAAGTAGGATGAAGGG + Intronic
1186966293 X:14789568-14789590 AACCCAGCAGGGAGGAATAAGGG + Intergenic
1190427544 X:50346928-50346950 AACCTAGGAGATTGGATGGAAGG - Intronic
1191109242 X:56792248-56792270 AACCCATGAGGTACGAGGTAAGG - Intergenic
1191884956 X:65878764-65878786 AATCAAGGAGGTTGAATGAAGGG + Intergenic
1195288519 X:103408950-103408972 AACCAAGGAGGTGGGATGGGAGG + Intergenic
1195478162 X:105311375-105311397 AACCCAGAAGAAAGCATGAAGGG - Intronic
1196020440 X:110985346-110985368 AAGCAGGGAGGTAGGAGGAAGGG - Intronic
1196650981 X:118167984-118168006 ACCACAGGAGGCAGAATGAATGG + Intergenic
1197013116 X:121591256-121591278 AACCCATGAGGTAGGAACCAGGG - Intergenic
1197523617 X:127532164-127532186 AAGCCAGTATGTAGGATGGATGG + Intergenic