ID: 1057879528

View in Genome Browser
Species Human (GRCh38)
Location 9:98782671-98782693
Sequence GCATTTAAGAAGGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057879524_1057879528 21 Left 1057879524 9:98782627-98782649 CCTGGGCAACAAAACCAACATTA 0: 1
1: 0
2: 6
3: 105
4: 2108
Right 1057879528 9:98782671-98782693 GCATTTAAGAAGGACATGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 360
1057879525_1057879528 7 Left 1057879525 9:98782641-98782663 CCAACATTAACTACAAAGCTCAG 0: 1
1: 0
2: 1
3: 9
4: 176
Right 1057879528 9:98782671-98782693 GCATTTAAGAAGGACATGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057879528 Original CRISPR GCATTTAAGAAGGACATGGA AGG Intronic
900775618 1:4582808-4582830 TCAGTTAATAAGGACTTGGATGG - Intergenic
902895366 1:19476075-19476097 GCATTTTAGAAGGTCAAGGCGGG + Intronic
903237533 1:21959861-21959883 GCATTTCAGGAGGCCATGGCAGG + Intergenic
903237545 1:21959911-21959933 GCATTTCAGGAGGCCATGGCAGG + Intergenic
903258493 1:22118434-22118456 GCTTGTGAGAAGGACATGCATGG - Exonic
903549204 1:24145970-24145992 GCATTTTGGAAGGCCAAGGAGGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905553470 1:38861926-38861948 GCATTTTGGGAGGCCATGGAGGG - Intronic
905914443 1:41675131-41675153 GGATTTAAGCAGGACAGGCATGG - Intronic
906078856 1:43070440-43070462 GAATTTGAGAAGGCCTTGGAGGG + Intergenic
906824582 1:48965324-48965346 GCATTTAAGCCAGACATAGAGGG + Intronic
907294583 1:53441912-53441934 GCAATTAAGAAGCAGATGTAGGG - Intergenic
907535943 1:55157530-55157552 CCCTTTAAAAAGAACATGGAGGG + Intronic
909117613 1:71558503-71558525 ACATATATGAATGACATGGAAGG - Intronic
910858844 1:91723597-91723619 TTATTCAACAAGGACATGGAAGG + Intronic
911367971 1:96962673-96962695 GCATTTAAAAAAGACATCAACGG - Intergenic
911667881 1:100574829-100574851 GGACTCAAGAAGGAAATGGAAGG - Intergenic
912168626 1:107070110-107070132 GCATTTAAGCAGGATCTTGAAGG - Intergenic
912659901 1:111518185-111518207 GAATATAAGACAGACATGGATGG + Intronic
913149828 1:116030084-116030106 GCAATGAAGAAGTAAATGGAAGG + Intronic
914772697 1:150704497-150704519 GCACTTTGGAAGGCCATGGAGGG + Intronic
915986157 1:160467061-160467083 GCATTTAAGAAGAAAATAAAGGG - Intergenic
916699623 1:167277962-167277984 AAATTTAACAAGGATATGGAGGG - Intronic
916843449 1:168624414-168624436 GCATTTTAGAAGGCCAAGGCGGG - Intergenic
918949429 1:191116687-191116709 GCATTTAAAAAAAACATGGAGGG + Intergenic
919050960 1:192510762-192510784 GAATCTAAGATGAACATGGAAGG + Intergenic
919106200 1:193154275-193154297 GCATTTCAGAGGTACAGGGATGG - Intronic
919367276 1:196678600-196678622 GTACTTTAGAAGTACATGGATGG + Intronic
919397788 1:197071999-197072021 GCAGTTAAGAAAGACAAAGAAGG + Intergenic
920368405 1:205460913-205460935 GCAACTAAGAAGGAAAAGGAAGG + Intergenic
922304611 1:224333223-224333245 GCCTTTAAGAAGGAGGTGGCTGG - Intergenic
923042669 1:230330909-230330931 GCATGTAAGGAGGATATTGATGG - Intronic
924256842 1:242191337-242191359 GCAGTTTAGAAGGCCATGGCAGG + Intronic
1064556364 10:16550713-16550735 GCCTTAAAGAGGGGCATGGAGGG - Intergenic
1064972232 10:21077739-21077761 GGATTTATGAATGAGATGGAAGG - Intronic
1064977129 10:21128864-21128886 GCATGAAAGAAGGACATACAGGG + Intronic
1065544524 10:26806010-26806032 GCATTAGAGAAAGACATGCATGG - Intronic
1066082743 10:31948292-31948314 GCATTTTGGGAGGACAAGGAGGG - Intergenic
1066435472 10:35393441-35393463 GAATTTAAAAAGGAAATGCAGGG - Intronic
1067322165 10:45231353-45231375 GCATTTTGGAAGGCCATGGCAGG - Intergenic
1068550111 10:58398003-58398025 GCACTTAAGGAGGCCAAGGAAGG - Exonic
1068577808 10:58704313-58704335 GCACTTAAAGAGAACATGGAAGG + Intronic
1069669458 10:70189513-70189535 GCATTTTAGAAGGCCAAGGCAGG + Intergenic
1071571689 10:86700672-86700694 GCATTTAGGAAGGGCTAGGAAGG + Intronic
1071823246 10:89298737-89298759 GCACTTAGGGAGGACAAGGAGGG + Intronic
1072483947 10:95836374-95836396 GCATTCAAAAAAGACTTGGAAGG + Intronic
1073373819 10:103015605-103015627 GCACTTTAGAAGGCCAAGGAGGG + Intronic
1073733795 10:106322826-106322848 ACATTTAAGAAGGACGTTCAGGG - Intergenic
1073846409 10:107560802-107560824 GCATTTTAGACAGACCTGGAAGG + Intergenic
1074265984 10:111903792-111903814 GCATATAGGAAGGACATCAAGGG - Intergenic
1075377726 10:121992706-121992728 GCATTTTAGGAGGCCAAGGAGGG + Intronic
1078365604 11:10703989-10704011 GCACTTTAGAAGGCCAAGGAGGG + Intergenic
1079486726 11:20942648-20942670 AAATTCAAGAAGGACATGTATGG - Intronic
1079901658 11:26194350-26194372 ACATTAAAGAAGGACTTGGTAGG + Intergenic
1080335148 11:31186778-31186800 GCATCTCAGAATGGCATGGAAGG - Intronic
1080616558 11:33949551-33949573 GCATTTAAGAGGAAAATGGTGGG - Intergenic
1080996957 11:37615368-37615390 CCATTTAAGGAAGACCTGGAGGG + Intergenic
1081319754 11:41677120-41677142 CCCCTTAAGAAGGCCATGGAGGG - Intergenic
1081508569 11:43744043-43744065 ACATTTAAAAAGTACATAGATGG + Intronic
1082993143 11:59226137-59226159 GCAGTTAATAAGGAGAGGGATGG + Intergenic
1083563234 11:63691365-63691387 GCATTTTAGGAGGCCAAGGAGGG - Intronic
1086264792 11:84984871-84984893 GCAGTTAAAAAAGACATAGAGGG + Intronic
1087518238 11:99194849-99194871 GCATTTTAGGAGGACAAGGCGGG - Intronic
1088199418 11:107315219-107315241 GAATTCAAGAAAGAAATGGAAGG + Intergenic
1088864198 11:113831368-113831390 CAATTTAAGAAGGACTTGTAAGG - Intronic
1092051953 12:5477732-5477754 CCAATAAAGAAGGAAATGGAGGG - Intronic
1092372428 12:7928151-7928173 GCATTTAGGAAGGCCGTGGCAGG + Intronic
1092676521 12:10927106-10927128 ACATTGGAGAAGGTCATGGAAGG + Intronic
1092914506 12:13177879-13177901 CCACCAAAGAAGGACATGGACGG + Intergenic
1092937898 12:13380726-13380748 GCCTTTTAAAAAGACATGGAGGG - Intronic
1093908213 12:24716471-24716493 GCATTTTACAAAGACCTGGAGGG + Intergenic
1094247428 12:28315410-28315432 GCATTTTAGAAGGCCAAGGTGGG - Intronic
1095374592 12:41511600-41511622 GCATTTGAGAACAACATGCATGG + Intronic
1095812722 12:46387520-46387542 GATTTTAAAAAGGAGATGGAAGG + Intergenic
1097260670 12:57718314-57718336 GAATTTGAGAAGGAACTGGAAGG + Exonic
1097892276 12:64789428-64789450 GCATTTTGGGAGGCCATGGAGGG - Intronic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098504198 12:71230197-71230219 GAAATTAAGAAGGAAATTGAAGG + Intronic
1099492629 12:83306047-83306069 TCAGTTAAGAAAGACAAGGAAGG - Intergenic
1100959918 12:99951215-99951237 ACATTTCAGAATGACATGGCTGG + Intronic
1101098488 12:101368377-101368399 GCATTTTAGGAGGCCAAGGAGGG - Intronic
1101281866 12:103265918-103265940 CCATTTAAGAAGAACATCAAAGG - Intronic
1101420284 12:104545177-104545199 GAATTTAAGAAGGCAATGAATGG - Intronic
1101678285 12:106939748-106939770 GCATTTTAGAAGGCCAAGGTAGG - Intergenic
1101960744 12:109247879-109247901 TCATTTTAGAATGACAAGGATGG - Intronic
1103814014 12:123638415-123638437 GCATTTTGGAAGGCCAAGGAGGG - Intronic
1106195559 13:27491317-27491339 GCCTTTAAGAAGGCAATTGAGGG + Intergenic
1106275401 13:28200872-28200894 ACATTTAAGGAGTAAATGGATGG - Intronic
1106683074 13:32028114-32028136 GCATTTTAGAAGGCCAAGGCGGG - Intergenic
1107834428 13:44402077-44402099 GCATTTAATAAAGGCAAGGAAGG + Intergenic
1108955586 13:56153203-56153225 GCATTTAAACAGGACAGGAAAGG - Intergenic
1109314701 13:60736260-60736282 GCATTTAACAAGCCCACGGATGG + Intergenic
1109570272 13:64179518-64179540 TCATTTAAGAAATACATTGATGG + Intergenic
1109598562 13:64592068-64592090 GAAGTTAAGAAGGTCATGTAAGG - Intergenic
1109643194 13:65218844-65218866 GCATTTATACAAGACATGGAAGG - Intergenic
1110182039 13:72628384-72628406 GCAGTTAAAAAGGACACAGAGGG + Intergenic
1110704700 13:78592195-78592217 GGATGTAAGAAGGTCATGGAGGG - Intergenic
1112501536 13:99946905-99946927 GCATTTTAGCAGGAAGTGGAAGG - Intergenic
1113240498 13:108331219-108331241 GCATTTAAAAAAGACAAAGAGGG + Intergenic
1114399316 14:22394958-22394980 GGATTGGAGAAGGACATGGCGGG + Intergenic
1114496867 14:23138915-23138937 ACATCTAAGAAGGACCTGGGAGG - Intronic
1119591004 14:75887946-75887968 GGATTGAAGAACAACATGGAGGG + Intronic
1119870489 14:78012619-78012641 GCATTTGAGATGGACATTGGAGG + Intergenic
1120375941 14:83707257-83707279 GCATGTAGGAAGGAAATTGATGG - Intergenic
1120736979 14:88064357-88064379 GAAATTAAGAAGGGCATGGGTGG - Intergenic
1121152243 14:91646231-91646253 GGAATTAAGAATGACATTGAGGG - Intronic
1124902560 15:33837807-33837829 GAATTCCAGAAGGCCATGGAAGG + Exonic
1125127783 15:36244500-36244522 GCATTCAATAAGTAAATGGATGG - Intergenic
1125326635 15:38541934-38541956 GCATTTGAGATGGACCTTGAAGG + Intronic
1126144029 15:45460661-45460683 GCACTTTAGGAGGCCATGGAGGG - Intergenic
1127136252 15:55926827-55926849 GCACTTAAGGAGGTCAAGGAAGG + Intronic
1127236728 15:57061344-57061366 GCACTTTAGGAGGCCATGGAGGG + Intronic
1127450397 15:59110862-59110884 GTAGTTAGAAAGGACATGGAAGG + Intronic
1129180506 15:73871552-73871574 GCATTAAAGAAGTCCAAGGAGGG - Intergenic
1130745841 15:86653141-86653163 GCATTTGAGGAGGTTATGGAAGG - Intronic
1131569223 15:93516788-93516810 GCATTTGAGAAAGACATATATGG + Intergenic
1131787534 15:95929150-95929172 ACATTTGAGAAGGGCCTGGAGGG - Intergenic
1135899817 16:26447038-26447060 GCATTTGAGAAGAAAATGTATGG + Intergenic
1137432048 16:48426534-48426556 GCAGTTAGGGAGGACAAGGAAGG - Intronic
1139796442 16:69486615-69486637 GCACTTAAGGAGGCCAGGGAGGG + Intergenic
1140199947 16:72886956-72886978 GCATTTGAAAAACACATGGAAGG + Intronic
1140459391 16:75126647-75126669 GCATTTAAGGAGGCCAAGGTGGG - Intergenic
1141088942 16:81116919-81116941 CCATTTAACAAAGACATTGAGGG - Intergenic
1142640832 17:1285015-1285037 GCATTTGGGAAGCAGATGGATGG + Intronic
1143570008 17:7751337-7751359 GCATTTTAGAAGGCCAAGGTGGG - Intronic
1143926111 17:10372093-10372115 GCATTAAAGACGGAGAAGGAAGG - Intronic
1144697885 17:17317716-17317738 GCACTTTGGAAGGCCATGGAGGG + Intronic
1145300782 17:21634850-21634872 GCATTTTGGAAGGCCAAGGAGGG - Intergenic
1145349518 17:22068405-22068427 GCATTTTGGAAGGCCAAGGAGGG + Intergenic
1147296070 17:39483508-39483530 GCACTTTAGAAGGCCAAGGAAGG - Intronic
1147465967 17:40611124-40611146 GCATTTAAGGAGGCCAAGGCTGG - Intergenic
1148398870 17:47336052-47336074 GAATTTAAGAAGGAAACAGAAGG + Intronic
1149485358 17:57038418-57038440 GCCTTTATGAAGGTCTTGGAAGG - Intergenic
1149710219 17:58734889-58734911 ACATTTAAAAAGAACATGGCTGG - Exonic
1150613971 17:66754830-66754852 GCATTTCCCAAGGACCTGGAAGG - Intronic
1150692867 17:67379542-67379564 GCATTTAAGCAGGGTCTGGAAGG + Intronic
1150718494 17:67593643-67593665 GCACTTTAGAAGGTCAAGGAGGG - Intronic
1151689121 17:75669679-75669701 GAAGTTAAGAAGGCCAGGGATGG - Intronic
1152044025 17:77924141-77924163 GCATTTTGGAAGGACAAGGTGGG + Intergenic
1153414653 18:4833581-4833603 GGGTTTGAGGAGGACATGGATGG + Intergenic
1153449024 18:5205939-5205961 GGAGTTAAGAAGGACCTAGAAGG + Intergenic
1153592349 18:6686922-6686944 GCTTTGAAGATGGAGATGGAGGG - Intergenic
1153593257 18:6697146-6697168 GCATTTTAGGAGGCCATGGCAGG + Intergenic
1153691348 18:7597099-7597121 GCACTTTAGAAGGACAAGGAGGG - Intronic
1155294108 18:24369973-24369995 GCATTTTAGGAGGCCAAGGATGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1156137221 18:34057078-34057100 GCCTTTAAGAGGGACATGTCAGG - Intronic
1158383872 18:56966862-56966884 GGATTCAAGAAGGACAGAGAGGG + Intronic
1158415720 18:57248209-57248231 GCATCTGAGATGGACCTGGAAGG + Intergenic
1159407059 18:68017518-68017540 GCATTTTAGGAGGCCAAGGAGGG - Intergenic
1159720758 18:71887534-71887556 GCATTTTAGGAGGACAAGGTGGG - Intergenic
1161537694 19:4830463-4830485 ACATTTAAAAAGGACAAGGTGGG - Intronic
1163501955 19:17681417-17681439 GCATTTCAGCGGGAGATGGATGG + Intronic
1163721850 19:18901680-18901702 GCACTTTAGAAGGCCAAGGAGGG + Intronic
1164044065 19:21519343-21519365 TCATTTAAGCAGCACATTGAAGG + Intronic
1165221780 19:34322416-34322438 GCATTTTGGAAGGACAAGGCAGG - Intronic
1165590655 19:36966664-36966686 ACATTGAAGAGGGACATTGAAGG + Intronic
1165660066 19:37570229-37570251 GGAGTGAAGTAGGACATGGATGG - Intronic
1166541547 19:43609023-43609045 GCATTTAGGAAGGACAAAGCCGG + Intronic
1166802321 19:45465846-45465868 GCATTTAAGAAGGCCAAGGCGGG + Intronic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
927319159 2:21722465-21722487 CCATTTAAGAATGGCTTGGAGGG + Intergenic
932629948 2:73332123-73332145 GCATTTTAGAAGGCCAAGGTGGG + Intergenic
932745958 2:74333776-74333798 GCATTTAGCCAGGAGATGGAAGG - Intronic
934767272 2:96886701-96886723 GCACTTGAGAAGGCCATGGTCGG + Intronic
934952521 2:98587278-98587300 GCAATTAAGAAGCACAGAGATGG - Intronic
935725803 2:106023109-106023131 GCATTTCAGGAGGCCATGGCAGG + Intergenic
935869180 2:107426734-107426756 GCATTTTATAAGTTCATGGATGG + Intergenic
937140971 2:119599898-119599920 GCACTTAATAAGCACATGAATGG + Intronic
937385382 2:121426268-121426290 GCATTTAAAAAAGACAAAGAAGG + Intronic
937611453 2:123866606-123866628 CCACTGAACAAGGACATGGAAGG + Intergenic
938550118 2:132372485-132372507 TCTTTTAAGAAGAACATGCAGGG - Intergenic
939912296 2:147998121-147998143 GCATTTAAGACTGACATGTCTGG + Intronic
940492659 2:154384115-154384137 GAATTTGAAAAGTACATGGAAGG + Intronic
940630522 2:156232094-156232116 GCAGTTAAAAAAGACAAGGAGGG + Intergenic
944664386 2:201947617-201947639 GCTTTTAAGAAACAGATGGAAGG - Intergenic
945610079 2:211989830-211989852 GCATTCAAGTAAGACATGGGTGG - Intronic
946821117 2:223630461-223630483 GCATTTTAGGAGGCCAAGGAAGG - Intergenic
947368628 2:229422751-229422773 TCATTAAAGAAGAAAATGGAAGG + Intronic
947919616 2:233857672-233857694 GCATTTAAACAGCACTTGGAGGG - Intergenic
948794016 2:240392966-240392988 GCATGTCAGGTGGACATGGATGG + Intergenic
1168874524 20:1161669-1161691 GCATTTGTGGTGGACATGGAGGG - Intronic
1170344522 20:15368707-15368729 GCATTTTGGGAGGACAAGGAGGG - Intronic
1172084381 20:32368929-32368951 TCATTTAAGAATGAGTTGGAGGG + Intronic
1172529511 20:35620215-35620237 GCATTTCAGAAGGCCGAGGAAGG - Intronic
1172877096 20:38171013-38171035 GCATTTAACAAGGAGTGGGAAGG + Intergenic
1173147656 20:40538647-40538669 TCATTTGAGATGGACATTGAGGG + Intergenic
1175100254 20:56574355-56574377 GCATTTAAGGAAGAAAGGGAGGG - Intergenic
1175269217 20:57722055-57722077 GCACTTTGGAAGGACATGGTGGG - Intergenic
1178336574 21:31749121-31749143 GCACTTCAGGAGGACAAGGAGGG - Intergenic
1179811516 21:43873622-43873644 GCATTTTAGAAGGCCAAGGTGGG - Intronic
1182609699 22:31536790-31536812 GCATTTCCCAAGGACTTGGAAGG - Intronic
1183574192 22:38676695-38676717 GCATTTCAGGAGGTCAAGGAAGG + Intergenic
951038131 3:17956356-17956378 GGAGATAGGAAGGACATGGAGGG - Intronic
951541848 3:23789478-23789500 GCATTGAAGAAGGGTAAGGATGG - Intergenic
951657409 3:25025168-25025190 GTATTTCAGAAGGACATCAAAGG - Intergenic
951731440 3:25814305-25814327 GCATTTTAGAAGGCCAAGGCAGG - Intergenic
951997344 3:28746039-28746061 AGAATTAAGAAGGGCATGGAAGG - Intergenic
952357642 3:32599415-32599437 GCATTTAGGAATAACATGGATGG + Intergenic
952912055 3:38199473-38199495 GCACTTTAGAAGGCCATGGCAGG - Intronic
953497539 3:43401208-43401230 GCATTTATGAAGGACGTGCTAGG + Intronic
954526278 3:51274529-51274551 GCATTTGGGGAGGACAAGGAGGG + Intronic
954628177 3:52034328-52034350 GCATTTTAGGAGGCCAAGGAGGG - Intergenic
955157394 3:56429982-56430004 GCATATAAGAAGGAAAGGGCTGG + Intronic
956821717 3:72959879-72959901 GCATTTTAGGAGGCCAAGGAGGG - Intronic
957680214 3:83424234-83424256 GCATTTAAAACAGACATGGATGG - Intergenic
958452929 3:94296335-94296357 GTTTTTAAGTAGGACATGCAGGG - Intergenic
958550328 3:95604383-95604405 GAATTTAAGAAGCAAATTGAAGG - Intergenic
958659284 3:97044537-97044559 GCAAATGAGAAGGACATGGTTGG - Intronic
959014604 3:101119804-101119826 GGATTTAAGGAACACATGGAGGG + Intergenic
959047387 3:101489544-101489566 ACAATTAAGAAGGACAAAGATGG + Intronic
959705063 3:109331945-109331967 GCAGTTTAGAAGGTAATGGAGGG + Exonic
960134830 3:114094710-114094732 GCAATAAAGAAGGTAATGGATGG - Intergenic
960778432 3:121289240-121289262 ATATTTAAGAAAGACATGAAGGG + Intronic
960976178 3:123176814-123176836 GCATTAAAGAAGAAGCTGGAGGG - Intronic
961977889 3:131045861-131045883 GCAGTTAAAAAGGACAAAGAGGG - Intronic
962965890 3:140354109-140354131 GAATTTCAGAAGGAAAGGGATGG + Intronic
963462978 3:145640444-145640466 GCATTTGAGAAGGGCTTTGAAGG + Intergenic
964134345 3:153327569-153327591 GCATTTTAGGAGGCCAAGGAGGG + Intergenic
964435679 3:156650371-156650393 GCTGTTGACAAGGACATGGATGG + Intergenic
965355061 3:167663692-167663714 TAATTTAAGAAGGACAGGGAAGG + Intergenic
965553248 3:169992047-169992069 GCCTTTAAGAAGGAAAAGCAGGG - Intronic
966028411 3:175314997-175315019 GCAATTAAAAAGGACTTGGTAGG - Intronic
967730233 3:192900441-192900463 GCATTTAAAAGGGACAAGAATGG + Intronic
971906750 4:32736106-32736128 GCATTTGGGAAGGAGGTGGAAGG - Intergenic
973264431 4:48197517-48197539 GCTTTCAAGAAGAACAAGGAAGG - Intronic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975301526 4:72796657-72796679 GCATTTTAGAAGGCCAAGGCAGG - Intergenic
975964486 4:79954263-79954285 GCATTTTAGAAGGCCAAGGTGGG - Intronic
976492785 4:85691595-85691617 ACAATTAAGAAGGACAAAGAAGG - Intronic
976543090 4:86300666-86300688 GCTTTTAAGAGAGACATGCAAGG - Intronic
977878518 4:102177507-102177529 GAATTTAAGAAGGGCAAGTAGGG - Intergenic
978321534 4:107501397-107501419 ACAAATAAGAGGGACATGGAGGG - Intergenic
981740176 4:147992801-147992823 TCATTTAAGATGGCCATGGAAGG + Intronic
982099997 4:151958419-151958441 GTATTTTAGAAAGACCTGGAAGG - Intergenic
983131497 4:164024971-164024993 ACAATTAAGAAGGACAAAGAAGG + Intronic
983403431 4:167295012-167295034 GAATTTAATAAGCAAATGGAAGG + Intergenic
983890030 4:173021165-173021187 GCATGGAAGAAGGAGATTGAAGG - Intronic
984239798 4:177204497-177204519 GAATTTAAAAAGAACAGGGAGGG + Intergenic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987739491 5:21887688-21887710 TCATATATGAAGGACCTGGAGGG - Intronic
987989041 5:25186720-25186742 GCATTTACCATGGAAATGGAGGG + Intergenic
988383483 5:30530491-30530513 GCATTAAACATGCACATGGAGGG - Intergenic
989989495 5:50744291-50744313 ACATTTCAGAAGGAAAAGGATGG + Intronic
990346503 5:54876769-54876791 GCCTTTCAGAAGGACAAGGTGGG - Intergenic
990539194 5:56755515-56755537 ACATTTACACAGGACATGGATGG + Intergenic
991082877 5:62620221-62620243 GCATTTAAGAAATACAGGGCTGG + Intronic
991538260 5:67697277-67697299 GCATTTTAGAAAGTCATGGGAGG - Intergenic
993618531 5:90141371-90141393 GCGCTTAAGAAGGAAATGGAGGG - Intergenic
994034206 5:95180031-95180053 GCAGTTAAGAAAGACAAAGAGGG + Intronic
994175390 5:96705071-96705093 GCACTTTAGAAGGCCAAGGAGGG + Intronic
994331077 5:98507416-98507438 GTCTTTTACAAGGACATGGATGG + Intergenic
994351589 5:98752520-98752542 GCATGAAAGAAGGGAATGGAAGG - Intergenic
995587466 5:113662959-113662981 GAATTTGAAAAGGACATGGCAGG - Intergenic
995712766 5:115051637-115051659 CAAATTCAGAAGGACATGGATGG - Intergenic
995945361 5:117638708-117638730 GCTTTTAAGATGGGCATGAATGG - Intergenic
997668302 5:135649738-135649760 GCATTGAAGATGCACATGCAGGG + Intergenic
998157321 5:139794557-139794579 GCATTTAAGGAGGAATTTGAGGG + Intergenic
998248326 5:140530459-140530481 GCATTTTAGAAGGCCAAGGCAGG - Intronic
1001200239 5:169709336-169709358 CCATATGAGAAGGACCTGGAGGG - Intronic
1003043016 6:2705455-2705477 GAATTTGAAAAGGACCTGGAGGG - Intronic
1003272462 6:4619629-4619651 GCCTTTAAGAAGTCCATGTATGG + Intergenic
1003465156 6:6372482-6372504 GCAATTAAAAAGGACAAAGAGGG + Intergenic
1004140703 6:13014474-13014496 ACAGTTAAGAAGCCCATGGAAGG - Intronic
1007326015 6:41060202-41060224 GCCTTTGAGGAGGAGATGGATGG - Intronic
1007891105 6:45292720-45292742 GCAGTTAAAAAAGACAAGGAGGG + Intronic
1008462192 6:51788543-51788565 GGATTTAACCAGTACATGGAAGG - Intronic
1008487912 6:52055233-52055255 GTACTTAAGACAGACATGGAAGG + Intronic
1009800053 6:68525881-68525903 GCAGTTAAAAAGGACAAAGAGGG - Intergenic
1009824889 6:68855770-68855792 GCATTTCAGAAGGCCACGGCAGG + Intronic
1010641390 6:78332384-78332406 GCATTTAAAATGGACCTTGAAGG + Intergenic
1010707529 6:79132897-79132919 GCAGTTAAAAAAGACAAGGAGGG - Intergenic
1010735673 6:79441556-79441578 GAACTAAAAAAGGACATGGAAGG - Intergenic
1013183924 6:107740989-107741011 GCAATAAAGAAGGGCATGGTTGG - Intronic
1013421931 6:109975042-109975064 GCATATTAGAATTACATGGAAGG - Intergenic
1013552640 6:111223669-111223691 GCTTATAATAAGGACATGAAAGG - Intronic
1014082760 6:117306638-117306660 GTATTTAAGCAGTAAATGGAAGG + Intronic
1014725402 6:124965695-124965717 GCAGATAAGAGGGCCATGGAGGG - Intronic
1015217110 6:130762936-130762958 GCATTTGAGATGGACCTTGAAGG + Intergenic
1015301983 6:131663438-131663460 GCACTTCAGAAGGCCAAGGAAGG + Intronic
1015322080 6:131887809-131887831 GCATTTTGGAAGGACAAGGCGGG - Intronic
1015959740 6:138634955-138634977 GCAATTAAGAATGAAATTGAAGG + Intronic
1017144245 6:151219667-151219689 TCACTTAAGAAGGAGATAGATGG + Intergenic
1017304996 6:152907085-152907107 GCATATAAAAAGCACATAGAAGG + Intergenic
1017870057 6:158479507-158479529 GCATTTTAGAAGGCCAAGGTGGG - Intronic
1018489006 6:164272585-164272607 GCTTTTTAAAAGTACATGGAGGG + Intergenic
1018596970 6:165491141-165491163 GCAGTTAAGAAAGACAAAGAGGG + Intronic
1020798346 7:12702810-12702832 GCATTTTAGGAGGACAAGGCAGG + Intergenic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1022861827 7:34375656-34375678 GAATGTAAGAAAGACAGGGAAGG - Intergenic
1024723603 7:52167053-52167075 GCATTTTGGGAGGACAAGGAAGG - Intergenic
1024731125 7:52254950-52254972 GCAAGTGAGAAGGAGATGGAGGG + Intergenic
1024800381 7:53071001-53071023 GCCTTTAGGAGAGACATGGAGGG - Intergenic
1026714637 7:72777667-72777689 GCATTTTAGAAGGCCAGGGTAGG + Intronic
1027855629 7:83507689-83507711 GCATTTTAGAAGGCCAAGGTGGG + Intronic
1028222915 7:88218319-88218341 ACACCTAATAAGGACATGGAGGG + Intronic
1028783534 7:94765539-94765561 GCATTTAAGGAGGCCAAGGTGGG - Intergenic
1028803924 7:95002311-95002333 TCATTTAAGAAGGCCTTGGGAGG + Intronic
1028928849 7:96390595-96390617 GCACTTTAGGAGGCCATGGAGGG - Intergenic
1029786942 7:102801620-102801642 GCAGTTAAAAAAGACATAGAAGG + Intronic
1030180363 7:106701406-106701428 GCAGTTAAAATGTACATGGAGGG - Intergenic
1030244882 7:107372257-107372279 GTCTTTAAGAAGTACATGGGAGG + Intronic
1030335666 7:108323373-108323395 GCATTTAAGCATGACATTGAAGG + Intronic
1030350444 7:108479053-108479075 GGATTTAGGAAGTACATGGGAGG - Intronic
1031081119 7:117257814-117257836 GCATTTAAGAGAGAAATGGCTGG - Intergenic
1031228142 7:119067994-119068016 GCACTTTAGAAGGCCAAGGAGGG - Intergenic
1031284490 7:119847492-119847514 GCACTTTAGGAGGCCATGGAGGG + Intergenic
1031374823 7:121010926-121010948 GAATGTAAGAAGTAAATGGAAGG - Intronic
1031522562 7:122784368-122784390 GTATTTAGAAAGTACATGGATGG - Intronic
1032707535 7:134434186-134434208 GCATTTTGGGAGGACAAGGAGGG - Intergenic
1033900897 7:146138259-146138281 GAATTTTAAAATGACATGGAAGG + Intronic
1034122587 7:148640942-148640964 GCATTTGTGAAGGACTTTGAAGG - Intergenic
1034705297 7:153137600-153137622 GCATTTAAAAAAGACAAAGAGGG - Intergenic
1035053642 7:156019306-156019328 GCATTTCAGAAGGACCTGACCGG + Intergenic
1035190284 7:157161698-157161720 GCACTTTGGAAGGCCATGGAGGG - Intronic
1036119463 8:6000124-6000146 GCATTTAAGATGGACTTTGAAGG + Intergenic
1037395625 8:18439040-18439062 GCAGTAAAGTAGAACATGGAAGG - Intergenic
1037709863 8:21347041-21347063 GCATTTTAGAAGGCCAAGGCTGG + Intergenic
1038189426 8:25305625-25305647 GAAATTAATAAGGACATGAAGGG + Intronic
1038915612 8:32018246-32018268 GTAATTAAGAAGAACATCGAGGG + Intronic
1039773184 8:40709457-40709479 GCCTTTAAGAAAAAGATGGAAGG + Intronic
1040291343 8:46127116-46127138 GCATTGAAGAAGGACAGAGCAGG - Intergenic
1040421974 8:47249300-47249322 GCATTTTGGAAGGCCAAGGAGGG - Intergenic
1040510234 8:48086816-48086838 GCATTTATGAGGGACATTCATGG + Intergenic
1040571410 8:48614744-48614766 GCATGTAAGGAGGCCAGGGAGGG - Intergenic
1041155306 8:54979273-54979295 GCATTTAAAAAAGACAAAGAAGG + Intergenic
1041191190 8:55356422-55356444 GAAATTTAAAAGGACATGGAAGG + Intronic
1041661328 8:60404390-60404412 GCACTGAGGAAGGACATGGAGGG - Intergenic
1041722956 8:60992893-60992915 GCATTAGGGAAGGTCATGGAAGG + Intergenic
1042046750 8:64661778-64661800 TCATTTAATAAGGACATTCACGG + Intronic
1042574659 8:70204743-70204765 GCACTTAGGGAGGACAAGGAGGG + Intronic
1042962476 8:74319271-74319293 TCTTTTAAGAAGGCCAGGGATGG - Intronic
1045987806 8:108269612-108269634 GCATTTTAGAGGGCCATGGCAGG - Intronic
1046105338 8:109658705-109658727 GCATTTTAGAAGGCCAAGGTGGG + Intronic
1046637809 8:116691626-116691648 GCACTTTAGAAGGACAAGGCAGG + Intronic
1049299280 8:141861263-141861285 GCAGTTAGGAAGGGCAGGGATGG - Intergenic
1049971831 9:828531-828553 GCATTTTGGGAGGCCATGGAGGG + Intergenic
1050239024 9:3614346-3614368 TCCTTTAACAGGGACATGGATGG - Intergenic
1050803696 9:9647197-9647219 ACATTTGAGAAGGAAATGAATGG - Intronic
1050845885 9:10217787-10217809 CCATTTAGGAAGGAGATGCAAGG + Intronic
1050903093 9:10969902-10969924 GAGTTTAACAAAGACATGGAGGG - Intergenic
1051757828 9:20423564-20423586 GCATTTAGGGAGGCCAAGGAAGG + Intronic
1052793687 9:32902482-32902504 ATATTTAAGCTGGACATGGATGG + Intergenic
1053363307 9:37504887-37504909 GCATTCTAGAAGGACATGAGTGG + Intergenic
1055842564 9:80522882-80522904 GAATTAAAGGAGGAAATGGAAGG - Intergenic
1057616604 9:96596612-96596634 GCATTTTAGGAGGCCAAGGAGGG + Intronic
1057792156 9:98131563-98131585 GCACTTCAGAAGGCCATGGCGGG - Intronic
1057879528 9:98782671-98782693 GCATTTAAGAAGGACATGGAAGG + Intronic
1059032886 9:110719474-110719496 GCAGTTAAGAAAGACAAAGAGGG + Intronic
1059194489 9:112358059-112358081 GCATTTTAGAAGGCCAAGGCAGG + Intergenic
1061783720 9:133010871-133010893 GTATTAAAGAAGGAAAAGGAAGG + Intergenic
1186048961 X:5569010-5569032 GCATTTCAGAATGACATTTATGG + Intergenic
1186145399 X:6619463-6619485 ACATTTGAGATGGAAATGGATGG + Intergenic
1186389596 X:9145352-9145374 GCAATTAAAAAGGAAATGAAAGG + Intronic
1187469731 X:19558561-19558583 GAATTTAAGGAGGAAAAGGAAGG - Intronic
1188623841 X:32259953-32259975 GCATCTGAGCAGGGCATGGAAGG + Intronic
1189289324 X:39874075-39874097 GCATTTCAGAAGGCCTAGGAGGG - Intergenic
1189690796 X:43614823-43614845 GAATTAAAGAAGCACATGGCAGG + Intergenic
1189922035 X:45911828-45911850 ACAGTGGAGAAGGACATGGAGGG + Intergenic
1192037674 X:67582842-67582864 GCATTTAAGATGGGCCTAGAGGG + Intronic
1192627783 X:72748047-72748069 GAAATTAAGAAGGACAATGAAGG + Intergenic
1192653925 X:72972762-72972784 GAAATTAAGAAGGACAATGAAGG - Intergenic
1194385244 X:93244437-93244459 GCATTTTAGAAGGCCAAGGCAGG + Intergenic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1195615888 X:106911545-106911567 GGATTCAAGGAGGACCTGGAAGG - Intronic
1196224970 X:113155979-113156001 GGATTTAAAAAAGACAAGGAGGG - Intergenic
1198136387 X:133755215-133755237 GCACTTTGGAAGGAAATGGAAGG - Intronic
1198241732 X:134794463-134794485 GCATTCAAGATGGATGTGGAAGG - Intronic
1199733770 X:150664632-150664654 GAATTTGAGAAGCACATGGGAGG + Intronic
1200736944 Y:6810065-6810087 TCATTTAAGAAAGACATACATGG + Intergenic
1201398958 Y:13582014-13582036 CCATTTAACAATGACAGGGATGG - Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic