ID: 1057880586

View in Genome Browser
Species Human (GRCh38)
Location 9:98790193-98790215
Sequence TCCAGCACGCTGAGGTGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057880582_1057880586 3 Left 1057880582 9:98790167-98790189 CCAGTGCAACCTCGAAGGCGGTC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1057880583_1057880586 -6 Left 1057880583 9:98790176-98790198 CCTCGAAGGCGGTCTTCTCCAGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1057880578_1057880586 18 Left 1057880578 9:98790152-98790174 CCCTGTGCTTGCAGTCCAGTGCA 0: 1
1: 0
2: 0
3: 18
4: 255
Right 1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1057880579_1057880586 17 Left 1057880579 9:98790153-98790175 CCTGTGCTTGCAGTCCAGTGCAA 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057880586 Original CRISPR TCCAGCACGCTGAGGTGGTC AGG Exonic
900116670 1:1032077-1032099 TCCAGCAGGGTGGGGTGGTTGGG + Intronic
900364765 1:2306599-2306621 TGCAGCACGCGGAGGCGGACCGG + Exonic
900853509 1:5162509-5162531 TCCAGCAAGATGAGGTCTTCAGG + Intergenic
901149627 1:7092587-7092609 TCCAGCAGGCTGAGGTTTTGGGG - Intronic
902461084 1:16577316-16577338 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
902461864 1:16583593-16583615 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
902462643 1:16589898-16589920 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
902695686 1:18139387-18139409 TCCAGCAGGGGGAGGTGCTCAGG - Intronic
903995355 1:27302015-27302037 TCCAGCACACTGAGGGGAGCTGG - Intronic
906201993 1:43966411-43966433 TACTGAACTCTGAGGTGGTCCGG + Intronic
906334009 1:44912675-44912697 TCCTAGGCGCTGAGGTGGTCAGG - Intronic
906688055 1:47775263-47775285 TCCAGCTGGCTGAGGCTGTCGGG + Exonic
913543315 1:119842432-119842454 TCAAGCAAGCTGAGGAGCTCAGG - Intergenic
913602836 1:120438625-120438647 TCAAGCAAGCTGAGGAGCTCAGG + Intergenic
913603584 1:120444978-120445000 TCAAGCAAGCTGAGGAGCTCAGG + Intergenic
913604339 1:120451261-120451283 TCAAGCAAGCTGAGGAGCTCAGG + Intergenic
913640438 1:120807688-120807710 TCAAGCAAGCTGAGGAGCTCAGG + Exonic
913641211 1:120813972-120813994 TCAAGCAAGCTGAGGAGCTCAGG + Exonic
914084204 1:144437944-144437966 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
914190223 1:145403215-145403237 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
914277271 1:146136352-146136374 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
914487669 1:148124898-148124920 TCAAGCAAGCTGAGGAGCTCAGG - Exonic
915273523 1:154772502-154772524 AAGAGCATGCTGAGGTGGTCAGG - Intronic
915510066 1:156382006-156382028 TCCAACAGGATGAGGTGGTGGGG + Intronic
916644436 1:166768928-166768950 CCCAGCACCCTAAGGTGATCAGG + Intergenic
917625258 1:176839546-176839568 TCCAGCCCGCAGTGGTGCTCGGG - Intronic
919020892 1:192104038-192104060 TCCAGAAAGCTGAGCTGCTCAGG - Intergenic
924729299 1:246697190-246697212 TCCAGAACGCTGAGCAGCTCAGG + Intergenic
1064152819 10:12879105-12879127 TCCAGCCCTCAGAGGTTGTCAGG - Intergenic
1065819941 10:29516439-29516461 TCCACCACGCTGAGGAGGGAGGG + Intronic
1069849715 10:71397008-71397030 GGCCGGACGCTGAGGTGGTCGGG + Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1073469419 10:103713640-103713662 ACCAGCCTGCTGAGGTGGTCAGG - Intronic
1076851006 10:133092978-133093000 TCCTGCACGGTGAGGTGTCCGGG - Intronic
1078823945 11:14908092-14908114 TCCAGCAAGCTGATTTGTTCAGG + Intronic
1083424343 11:62575420-62575442 GCCAGCTCGCTGAGGAGGGCAGG + Exonic
1085507434 11:77068283-77068305 GCCAGCACACAGAGGTGCTCAGG + Intronic
1091079707 11:132654871-132654893 TCCAGCCCTCTGAGGTGGCCTGG - Intronic
1093471478 12:19506558-19506580 TCCAGCACTCTGAAGTTTTCTGG + Intronic
1100888566 12:99099408-99099430 TCCAGGACACTGTGGTAGTCAGG + Intronic
1101027306 12:100623731-100623753 TTCAGGAGGCTGAGGTGTTCTGG - Exonic
1103925510 12:124421640-124421662 TCCACCAAGCTGGGGTGGGCAGG + Intronic
1104405282 12:128511681-128511703 TCCACCACACTTAGGTGGTGGGG - Intronic
1104974847 12:132547853-132547875 ACCAGCAGGCCCAGGTGGTCGGG - Intronic
1107085064 13:36418326-36418348 TCCATCTCCCTGAGGTGTTCTGG - Intergenic
1109212604 13:59551159-59551181 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1111397187 13:87678215-87678237 TCCAGCACTTCGAGGTAGTCCGG - Exonic
1113664841 13:112134354-112134376 TCCAGAACGCAGAGGTCATCCGG - Intergenic
1119706049 14:76783181-76783203 TTCAGCAGGCTGAGGAAGTCTGG - Intergenic
1120886023 14:89452385-89452407 CCCAGCACGCTGGGGAGGGCCGG + Intronic
1121120259 14:91371917-91371939 CCCAGCAGGCTGGGGTGGTCTGG - Intronic
1122275992 14:100591039-100591061 TCCAGCAGGTGGAGGTGGTTTGG + Intergenic
1122598614 14:102909743-102909765 TGGAGCAGGCTGACGTGGTCTGG - Exonic
1125882750 15:43208305-43208327 TCCAGCACTCTGTGGAAGTCTGG + Exonic
1127525732 15:59790854-59790876 TCCAGCAGGCAGAGGTGGGATGG + Intergenic
1128499700 15:68219349-68219371 TCCAGCACTGTGAGGAGGTCAGG + Intronic
1130762430 15:86834303-86834325 TCTTGCACACTGAGCTGGTCTGG - Intronic
1134182528 16:12059293-12059315 GCCGGCACCCAGAGGTGGTCAGG - Intronic
1140142247 16:72269564-72269586 TCCAGCAAACTGAAGTGGTCAGG - Intergenic
1141460689 16:84177062-84177084 TCCAGCACGCATCGGTGGCCAGG + Intronic
1142365026 16:89645653-89645675 TCCTGCCCGCTGAGGTGGTGCGG + Exonic
1144007775 17:11116675-11116697 CCCAGGAGGCTGAGGTGGGCAGG - Intergenic
1144356915 17:14455122-14455144 GCCAGCACTCTGGGGTGGTATGG - Intergenic
1144431749 17:15198760-15198782 TCCAGCTTGCTGTGCTGGTCAGG - Intergenic
1147235118 17:39051414-39051436 TCCAGAAGGCTGGGGTGGCCCGG + Intergenic
1148929979 17:51120348-51120370 GCAAGCACGCTGAGGAGGTGAGG - Exonic
1151599768 17:75099055-75099077 TCCAGCATGCTCAGGTGTGCAGG + Intronic
1157271623 18:46280674-46280696 TTCAGGAGGCTGAGGTGGTGGGG - Intergenic
1161020752 19:2010330-2010352 TCCAGCGCGCTGAGATGGACGGG + Intronic
1161638328 19:5403385-5403407 TGAAGCAGGCTGATGTGGTCAGG + Intergenic
1162245187 19:9394091-9394113 TTCAGGAGGCTGAGGTGGGCAGG + Intergenic
1163746519 19:19052040-19052062 GCCACCACACTGACGTGGTCAGG + Exonic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1168142493 19:54398288-54398310 TCCAGGTAGATGAGGTGGTCGGG + Intergenic
1168511442 19:56977018-56977040 TCCAGAAAGCTGAGGGGTTCAGG - Intergenic
1202677516 1_KI270711v1_random:21056-21078 TCAAGCAAGCTGAGGAGCTCAGG - Intergenic
1202678303 1_KI270711v1_random:27336-27358 TCAAGCAAGCTGAGGAGCTCAGG - Intergenic
932284198 2:70518792-70518814 TCCACTCTGCTGAGGTGGTCAGG - Intronic
937724492 2:125145780-125145802 TCCAGCACACTGAGGTCCTAAGG - Intergenic
938714369 2:134006064-134006086 TTCAGGAGGCTGAGGTGGGCTGG - Intergenic
938907834 2:135855421-135855443 TTCAGGAGGCTGAGGTGGTAAGG + Intronic
942115731 2:172727209-172727231 TGCAGCTCCCTGAGGTGGCCAGG + Intergenic
945890066 2:215421201-215421223 CCCAGCATGATGTGGTGGTCTGG + Intronic
947386788 2:229598709-229598731 TCCACCAAGAAGAGGTGGTCTGG + Intronic
948657351 2:239484834-239484856 TCACGCACGCTGGGGTGGTGAGG + Intergenic
948826869 2:240577237-240577259 CCCAGCAGGCTGTGGTGGCCTGG - Intronic
1170811971 20:19681155-19681177 CCCAGCAGGCTGAGGTGGGAAGG - Intronic
1171970449 20:31561723-31561745 TCAAGCATGCTCAGGTGGGCAGG + Exonic
1172657161 20:36544232-36544254 TCAAGCTCCCTGAGGTGGACAGG + Intronic
1172785457 20:37465422-37465444 CCCAGCACTCTGAGGGGGTGAGG - Intergenic
1179571659 21:42282172-42282194 TCCAGCAGGCTGAGGGCGGCTGG + Intronic
1179682133 21:43030051-43030073 ACCAGCCCGCTGATGTGGGCAGG - Exonic
1180884180 22:19228119-19228141 TGCATCACTCTGAAGTGGTCTGG - Intronic
1183069299 22:35385151-35385173 CCCAGCATGCAGAGGTGGTGGGG + Intronic
1184103001 22:42351381-42351403 GCCGACATGCTGAGGTGGTCAGG + Intergenic
1184233764 22:43172202-43172224 ACCAGAACTCTGAGGTGGGCAGG + Intronic
1185299246 22:50070940-50070962 GCCAGCACTCTCAGGTGTTCAGG - Intronic
951220413 3:20063292-20063314 CCCAGCACGCTGGGAAGGTCAGG - Intronic
962350039 3:134650014-134650036 TCCAGGACCCTGAGGTTCTCTGG + Intronic
963084538 3:141424739-141424761 TCAAGCACTGTGAGGGGGTCTGG + Intronic
966256877 3:177927099-177927121 ACTAGCACGATGAGGTGATCTGG - Intergenic
967079012 3:186031860-186031882 CCTAGCACTCTGAGGTGGGCAGG + Intergenic
967087444 3:186108336-186108358 CCCAGCAGGCTGAGGGCGTCCGG - Intronic
972601486 4:40576685-40576707 CCCAGCACCCTGAGGGGCTCAGG - Intronic
973009814 4:45058468-45058490 TTTAGCACCCTGAGTTGGTCTGG + Intergenic
973330360 4:48906218-48906240 CCCCCCACGCTGGGGTGGTCCGG + Intronic
978804546 4:112786630-112786652 TTCAGGAGGCTGAGGTGGGCAGG - Intergenic
985165582 4:187090927-187090949 TCCAGCATCCTGAGGTGGTGAGG + Intergenic
985480415 5:107158-107180 TCCAGCAGGCAGAGATGGGCAGG - Intergenic
996421140 5:123264035-123264057 TCCAGCACCCTGAGAAGGTGGGG + Intergenic
996606463 5:125328983-125329005 TCCAGCACACAAAGGTGGTGAGG + Intergenic
1005273956 6:24196665-24196687 TCTGGGAGGCTGAGGTGGTCTGG - Intronic
1008279244 6:49576353-49576375 TCAAGCATCCTGAGGTGCTCTGG - Intergenic
1013367100 6:109444790-109444812 TCCTGCACCCTGTGGAGGTCAGG + Exonic
1020225654 7:6277948-6277970 TCCAGGAGGCTGAGGTGGGAGGG - Intergenic
1020256006 7:6503507-6503529 TCCGGCTCGCTGAGGCGGCCGGG + Exonic
1032551366 7:132787295-132787317 TCCATCATGCTGAGGATGTCAGG - Intronic
1033566064 7:142579312-142579334 TCCATCATGCTGATGTGGTGGGG + Intergenic
1035977121 8:4324858-4324880 TCCAGGACCCTGAGGTGTGCTGG - Intronic
1041120066 8:54577256-54577278 TCCGGGAGGCTGAGGTGGGCAGG - Intergenic
1047960941 8:130011223-130011245 TCAAGAACGCTGAGGCGGCCAGG + Intronic
1049432658 8:142572407-142572429 TCCAGCAAGAGCAGGTGGTCTGG - Intergenic
1049455459 8:142684186-142684208 TCCAGAATGCTGAGATGGCCAGG + Intergenic
1055252108 9:74320328-74320350 TCTAGCACCCTGAAGTGATCTGG - Intergenic
1057132762 9:92666204-92666226 TCCCCAAGGCTGAGGTGGTCCGG + Intronic
1057238189 9:93383221-93383243 TTCAGGAGGCTGAGGTGGGCGGG + Intergenic
1057880586 9:98790193-98790215 TCCAGCACGCTGAGGTGGTCAGG + Exonic
1061527263 9:131176432-131176454 TCCAGGAGGCTGAGGTGGGAAGG - Intronic
1061650902 9:132049145-132049167 TCCTGCACAATGAGGTGGTTAGG - Intronic
1062244724 9:135559803-135559825 TCCTGCTCGCTGAGGTTGCCCGG + Intergenic
1189619883 X:42824854-42824876 TTCAGCACCTTGAGTTGGTCTGG - Intergenic
1194664973 X:96667294-96667316 TTCAGGAGGCTGAGGTGGGCTGG + Intergenic
1200106932 X:153719420-153719442 TCAAGAACACTGAGGTGCTCAGG + Intronic