ID: 1057885639

View in Genome Browser
Species Human (GRCh38)
Location 9:98827628-98827650
Sequence GCCCTAGGCATTGTTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057885639_1057885642 -7 Left 1057885639 9:98827628-98827650 CCAGGAGGAACAATGCCTAGGGC 0: 1
1: 0
2: 1
3: 14
4: 97
Right 1057885642 9:98827644-98827666 CTAGGGCCCATGAAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057885639 Original CRISPR GCCCTAGGCATTGTTCCTCC TGG (reversed) Intronic
904440154 1:30524841-30524863 GCCCCAGCCACTGTTCCTCCTGG - Intergenic
906032626 1:42733551-42733573 AGCCTAGGCATTGTGCCCCCAGG + Exonic
906060219 1:42943620-42943642 ACCCTAGGCATGGCTCCACCAGG - Intronic
915977256 1:160399768-160399790 GGCCAAGGCATTTTTCCTCTTGG + Intergenic
917636678 1:176943930-176943952 CCTCTAGGCATTGATTCTCCAGG + Exonic
920736066 1:208534038-208534060 TCCCTGGGCAGTGTTTCTCCAGG + Intergenic
923763540 1:236870575-236870597 ACCCCAGGCCTTGTTACTCCAGG - Intronic
924202660 1:241675475-241675497 GCATTTGGCATTGTTCCTCAGGG + Intronic
1063275280 10:4559823-4559845 TCCCTAGAAATTATTCCTCCTGG - Intergenic
1063369541 10:5512207-5512229 GCCCTAACCATCGTTCCTTCAGG + Intergenic
1067576012 10:47409165-47409187 GCCCTGGGCATCCTCCCTCCAGG + Intergenic
1070694497 10:78551994-78552016 GCCCAGTGCAGTGTTCCTCCTGG + Intergenic
1071530454 10:86387402-86387424 GCACTAGGCCTTGCTCCGCCAGG + Intergenic
1072678145 10:97484239-97484261 GCCCTAGGCTTTGTACCTGGGGG + Intronic
1074247745 10:111712269-111712291 GCCCTAGGCTTTGTTCTTCTGGG - Intergenic
1074943471 10:118257495-118257517 GCCCAAGGCATTAGTCCTCTTGG - Intergenic
1079025386 11:16943807-16943829 GCCCTGGGCTTAGTTTCTCCTGG - Intronic
1083350771 11:62027320-62027342 GGCCTTGGCATTGCTCCTCCCGG + Intergenic
1083399313 11:62413143-62413165 GCCCTAGGCATTGTGGCTGGTGG + Intronic
1083590124 11:63888850-63888872 GCCCTAGGCCTGGCTCTTCCCGG + Intronic
1084523908 11:69684239-69684261 GCCTGAGGCATTGTCCCTCTAGG + Intergenic
1084564552 11:69921621-69921643 GCCCGAGGTCTGGTTCCTCCTGG - Intergenic
1088544442 11:110945686-110945708 TCCCTAGGCACTGTTCTTCAGGG + Intergenic
1088793829 11:113250147-113250169 GTCTTAGGCATTGTTCCTGCTGG - Intronic
1090745198 11:129699748-129699770 GCACTTGGAATTGTCCCTCCTGG + Intergenic
1091719286 12:2800971-2800993 GCCTCAGGCCTTGTTCTTCCTGG + Intronic
1092123887 12:6062742-6062764 GCCCTGGGGATTCTTCCTGCTGG - Intronic
1092957028 12:13560595-13560617 GCCCTTCGCCTTCTTCCTCCTGG + Exonic
1096195851 12:49648368-49648390 GCCCTAGGCATTCCTCAGCCAGG - Intronic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1100010280 12:89944601-89944623 GCCTTAGGCACTGTTCCTGCTGG + Intergenic
1102943430 12:116963739-116963761 GCCCTAGCCATAGTTCCTGCAGG - Intronic
1104288493 12:127447121-127447143 TTCCTATGCATTGTTCCCCCAGG + Intergenic
1109494486 13:63149820-63149842 GACCTATGAATTGTTACTCCAGG - Intergenic
1111094673 13:83497155-83497177 GCCCAATGCATTGGTCGTCCTGG - Intergenic
1119437850 14:74609822-74609844 GTCCAAGGCATTGTTCCTGCTGG - Intronic
1122114796 14:99522297-99522319 GCCCTGGGCATGGCTCCTCACGG + Intronic
1122580330 14:102767762-102767784 GCCAGAGGCTTTGGTCCTCCTGG - Intergenic
1125330705 15:38579600-38579622 GCCCTCGGCACTGTGCCTCCTGG + Intergenic
1126456868 15:48872351-48872373 GCCCTAGATAATGTTCCACCTGG - Intronic
1126460213 15:48906823-48906845 GCCCTAGGCATATTTACTTCTGG - Intronic
1132720871 16:1315031-1315053 GCCCGAGGCCTTGTTCCCTCCGG + Intronic
1133520470 16:6551052-6551074 GCCCCAGGAATTTTGCCTCCTGG + Intronic
1135244986 16:20847895-20847917 GCCCAAATCATTGTTCTTCCTGG + Intronic
1138602696 16:58066129-58066151 GCCCTAGGCACTGGGCCTGCTGG + Intergenic
1142010795 16:87712842-87712864 GGCCTAGGCATTGGGTCTCCTGG + Intronic
1150819842 17:68426299-68426321 GTCCTAGGCACAGTACCTCCAGG - Intronic
1152554722 17:81047092-81047114 ACCCTGGGCATTGGCCCTCCTGG + Intronic
1153652025 18:7249370-7249392 GCCCAAGGCCTTTTTCCTCCAGG + Intergenic
1153712125 18:7810188-7810210 GCTCTAGTCCTTGTTCCTCTAGG + Intronic
1156796286 18:41050403-41050425 GCCTTTGGCAGAGTTCCTCCAGG - Intergenic
1157738152 18:50069071-50069093 GGGCTAGGCACTGATCCTCCTGG - Intronic
1166801979 19:45463454-45463476 GCCCTAGGCACTGTGCCCCTGGG - Intronic
925076746 2:1022874-1022896 TCCCTAGGCCTTGTTTCTCAAGG - Intronic
932773858 2:74515607-74515629 GCCCTGGTCTTTCTTCCTCCCGG + Intronic
936692608 2:114910316-114910338 GCCCTAGGCATTGTACCTAATGG + Intronic
945811012 2:214550149-214550171 GCCCTAGGGATTGTTCTTTCTGG - Intronic
946305954 2:218857245-218857267 GCCCTAGGAATTGGGACTCCAGG + Intergenic
947694405 2:232171904-232171926 CCAGTAGGCATTTTTCCTCCTGG - Intronic
948302199 2:236915800-236915822 GCCCTTGACATTGTATCTCCTGG + Intergenic
948388346 2:237595499-237595521 GCCCCTGGCATTGTGCTTCCGGG - Exonic
948515984 2:238504261-238504283 GCCCTTGGCCATTTTCCTCCTGG - Intergenic
949027506 2:241773487-241773509 GCCCTGGGCCGGGTTCCTCCTGG + Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1173192818 20:40888966-40888988 GCCCTGGGCATTGGGCCCCCAGG - Intergenic
1175876246 20:62231587-62231609 GCCCTTGGCATGGCACCTCCAGG + Intergenic
1178983564 21:37284502-37284524 GCCCTAGGGACGGGTCCTCCAGG + Intergenic
1179880989 21:44293283-44293305 GCCCCAGGCCCTGTGCCTCCCGG - Intronic
1180223116 21:46372444-46372466 GCCCCAGGCATTCATCCTGCAGG - Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1182566236 22:31202135-31202157 GACCTAGGCATGGTTCCCACAGG - Intronic
949365082 3:3271946-3271968 GCCCTAGGGAGTGCTGCTCCTGG + Intergenic
950785119 3:15427809-15427831 GCCTCAGGCAATGTTCCTCGCGG - Exonic
955454068 3:59100903-59100925 GCCTTAGGCATTGGTCTCCCTGG + Intergenic
961495086 3:127285409-127285431 ACCCCAGGCTTTTTTCCTCCTGG - Intergenic
962320890 3:134389401-134389423 TCCTTAGCCATTGTTCCTCATGG - Intergenic
963836738 3:150065625-150065647 GCCCTAGGCATTGTGCCTGATGG + Intergenic
968555552 4:1244828-1244850 GCCCTAGTCTTTGGGCCTCCAGG - Intronic
969180351 4:5435941-5435963 GCCCTAGGGTTTCGTCCTCCAGG - Intronic
971588175 4:28432351-28432373 GGCCTAGGGATTGCTCCACCTGG - Intergenic
973760332 4:54109364-54109386 GCCCTGGGTTTTGTTACTCCGGG + Intronic
975417657 4:74123840-74123862 GCCCTAGGCACTATGCCTACTGG + Intronic
981150179 4:141371426-141371448 GCCCTCGGCATTGGATCTCCTGG + Intergenic
986972144 5:13349379-13349401 GCCCCAGGCTGTGTTGCTCCAGG + Intergenic
987089629 5:14499177-14499199 GCCCTGGGCCTGGCTCCTCCTGG - Intronic
991638288 5:68728228-68728250 ACCCTAGGAACTGCTCCTCCAGG - Intergenic
996288051 5:121818326-121818348 GCCATTGGCATTCTTCCTGCAGG + Intergenic
1002106113 5:176880113-176880135 GCTCCAGGCACTGTCCCTCCTGG - Exonic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007488501 6:42199307-42199329 GCCCTAGGCACTGTGCCTACTGG + Intergenic
1018181822 6:161229809-161229831 GCCCTAGGAAGCCTTCCTCCGGG + Intronic
1018469982 6:164086469-164086491 GCCCTAGAAATTGTCCTTCCGGG - Intergenic
1029571669 7:101373883-101373905 GCCATAGGAATTGTTTCTCTGGG - Intronic
1034265410 7:149778219-149778241 GGACTAGGCCTGGTTCCTCCCGG - Intergenic
1035998670 8:4577541-4577563 GCCCACGGCATCCTTCCTCCGGG + Intronic
1039422382 8:37453856-37453878 CCCCAAGGCAGTGTTCCTCAAGG - Intergenic
1042462483 8:69086744-69086766 GCCCTTTGCACAGTTCCTCCTGG - Intergenic
1049044906 8:140141972-140141994 GCCCTGTGCTTTGTTCCCCCAGG - Intronic
1049470184 8:142771826-142771848 GCCCTGGGCAGGCTTCCTCCAGG - Intronic
1049622812 8:143606212-143606234 GCTCTGGGCATTGTTCCTGAAGG - Intronic
1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG + Intergenic
1050609027 9:7331884-7331906 GCCCCAGGCATTTCTCATCCAGG + Intergenic
1050645060 9:7710853-7710875 GCCTTGGGCATTTTTCCTCTTGG + Intergenic
1053343146 9:37356358-37356380 GCCCAAGAGATTATTCCTCCAGG - Intronic
1054451188 9:65404294-65404316 GCTATGGGCAGTGTTCCTCCTGG - Intergenic
1057885639 9:98827628-98827650 GCCCTAGGCATTGTTCCTCCTGG - Intronic
1059779582 9:117512365-117512387 TCACTAGGCATTGTTTCTCCTGG + Intergenic
1190245543 X:48688273-48688295 GCCCCTGGCCTTTTTCCTCCTGG + Intronic
1193437193 X:81489770-81489792 GCCCTCGCCATTCTGCCTCCAGG + Intergenic
1194223784 X:91228569-91228591 GCCACAGGCTTTGTTTCTCCTGG + Intergenic
1199208083 X:145173051-145173073 GCCTTAGGCATTATTCCTAAAGG - Intergenic
1200560248 Y:4691951-4691973 GCCACAGGCTTTGTTTCTCCTGG + Intergenic