ID: 1057888761

View in Genome Browser
Species Human (GRCh38)
Location 9:98852155-98852177
Sequence CAGTAACTCCATCTTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057888761_1057888764 1 Left 1057888761 9:98852155-98852177 CCCTGTTCAAGATGGAGTTACTG No data
Right 1057888764 9:98852179-98852201 GGTTTGAACACCCCTGACACTGG No data
1057888761_1057888768 13 Left 1057888761 9:98852155-98852177 CCCTGTTCAAGATGGAGTTACTG No data
Right 1057888768 9:98852191-98852213 CCTGACACTGGCCCACAGTATGG No data
1057888761_1057888769 14 Left 1057888761 9:98852155-98852177 CCCTGTTCAAGATGGAGTTACTG No data
Right 1057888769 9:98852192-98852214 CTGACACTGGCCCACAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057888761 Original CRISPR CAGTAACTCCATCTTGAACA GGG (reversed) Intergenic
No off target data available for this crispr