ID: 1057890405

View in Genome Browser
Species Human (GRCh38)
Location 9:98865584-98865606
Sequence CCTTGGAAGTCTGTGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057890405_1057890414 21 Left 1057890405 9:98865584-98865606 CCCCATCTCACAGACTTCCAAGG No data
Right 1057890414 9:98865628-98865650 GGAGTAGTTGGTTCTTTGTCAGG No data
1057890405_1057890411 0 Left 1057890405 9:98865584-98865606 CCCCATCTCACAGACTTCCAAGG No data
Right 1057890411 9:98865607-98865629 CTCTCGGCAACACTTTCCATTGG No data
1057890405_1057890412 9 Left 1057890405 9:98865584-98865606 CCCCATCTCACAGACTTCCAAGG No data
Right 1057890412 9:98865616-98865638 ACACTTTCCATTGGAGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057890405 Original CRISPR CCTTGGAAGTCTGTGAGATG GGG (reversed) Intergenic
No off target data available for this crispr