ID: 1057891807

View in Genome Browser
Species Human (GRCh38)
Location 9:98875296-98875318
Sequence CCCAGGGCACACCTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057891807_1057891812 -7 Left 1057891807 9:98875296-98875318 CCCAGATCAAGGTGTGCCCTGGG No data
Right 1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG No data
1057891807_1057891816 14 Left 1057891807 9:98875296-98875318 CCCAGATCAAGGTGTGCCCTGGG No data
Right 1057891816 9:98875333-98875355 GGCCTCTCTCCGTGGCTTGTAGG No data
1057891807_1057891814 6 Left 1057891807 9:98875296-98875318 CCCAGATCAAGGTGTGCCCTGGG No data
Right 1057891814 9:98875325-98875347 TCCTCTGAGGCCTCTCTCCGTGG No data
1057891807_1057891818 17 Left 1057891807 9:98875296-98875318 CCCAGATCAAGGTGTGCCCTGGG No data
Right 1057891818 9:98875336-98875358 CTCTCTCCGTGGCTTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057891807 Original CRISPR CCCAGGGCACACCTTGATCT GGG (reversed) Intergenic
No off target data available for this crispr