ID: 1057891809

View in Genome Browser
Species Human (GRCh38)
Location 9:98875297-98875319
Sequence TCCCAGGGCACACCTTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057891809_1057891818 16 Left 1057891809 9:98875297-98875319 CCAGATCAAGGTGTGCCCTGGGA No data
Right 1057891818 9:98875336-98875358 CTCTCTCCGTGGCTTGTAGGTGG No data
1057891809_1057891812 -8 Left 1057891809 9:98875297-98875319 CCAGATCAAGGTGTGCCCTGGGA No data
Right 1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG No data
1057891809_1057891814 5 Left 1057891809 9:98875297-98875319 CCAGATCAAGGTGTGCCCTGGGA No data
Right 1057891814 9:98875325-98875347 TCCTCTGAGGCCTCTCTCCGTGG No data
1057891809_1057891816 13 Left 1057891809 9:98875297-98875319 CCAGATCAAGGTGTGCCCTGGGA No data
Right 1057891816 9:98875333-98875355 GGCCTCTCTCCGTGGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057891809 Original CRISPR TCCCAGGGCACACCTTGATC TGG (reversed) Intergenic
No off target data available for this crispr