ID: 1057891812

View in Genome Browser
Species Human (GRCh38)
Location 9:98875312-98875334
Sequence CCCTGGGATGGCTTCCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057891807_1057891812 -7 Left 1057891807 9:98875296-98875318 CCCAGATCAAGGTGTGCCCTGGG No data
Right 1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG No data
1057891809_1057891812 -8 Left 1057891809 9:98875297-98875319 CCAGATCAAGGTGTGCCCTGGGA No data
Right 1057891812 9:98875312-98875334 CCCTGGGATGGCTTCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057891812 Original CRISPR CCCTGGGATGGCTTCCTCTG AGG Intergenic
No off target data available for this crispr