ID: 1057892213

View in Genome Browser
Species Human (GRCh38)
Location 9:98877772-98877794
Sequence AGTATTTGTGAGGTTTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057892210_1057892213 -9 Left 1057892210 9:98877758-98877780 CCTTTCCTCTTTGTAGTATTTGT No data
Right 1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG No data
1057892209_1057892213 -8 Left 1057892209 9:98877757-98877779 CCCTTTCCTCTTTGTAGTATTTG No data
Right 1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG No data
1057892207_1057892213 20 Left 1057892207 9:98877729-98877751 CCTGTAAACAGCTGTGCAGTCAC No data
Right 1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG No data
1057892206_1057892213 21 Left 1057892206 9:98877728-98877750 CCCTGTAAACAGCTGTGCAGTCA No data
Right 1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG No data
1057892208_1057892213 -7 Left 1057892208 9:98877756-98877778 CCCCTTTCCTCTTTGTAGTATTT No data
Right 1057892213 9:98877772-98877794 AGTATTTGTGAGGTTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057892213 Original CRISPR AGTATTTGTGAGGTTTTAGA TGG Intergenic
No off target data available for this crispr