ID: 1057894221

View in Genome Browser
Species Human (GRCh38)
Location 9:98894203-98894225
Sequence ATGGGAAAAAGCAGCATTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057894221_1057894225 14 Left 1057894221 9:98894203-98894225 CCGACAATGCTGCTTTTTCCCAT No data
Right 1057894225 9:98894240-98894262 GGTTATTTTAGTACAAATTTAGG No data
1057894221_1057894228 30 Left 1057894221 9:98894203-98894225 CCGACAATGCTGCTTTTTCCCAT No data
Right 1057894228 9:98894256-98894278 ATTTAGGAGAAGAAGGCATTGGG No data
1057894221_1057894226 23 Left 1057894221 9:98894203-98894225 CCGACAATGCTGCTTTTTCCCAT No data
Right 1057894226 9:98894249-98894271 AGTACAAATTTAGGAGAAGAAGG No data
1057894221_1057894222 -7 Left 1057894221 9:98894203-98894225 CCGACAATGCTGCTTTTTCCCAT No data
Right 1057894222 9:98894219-98894241 TTCCCATTATTACAGTAGTTTGG No data
1057894221_1057894227 29 Left 1057894221 9:98894203-98894225 CCGACAATGCTGCTTTTTCCCAT No data
Right 1057894227 9:98894255-98894277 AATTTAGGAGAAGAAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057894221 Original CRISPR ATGGGAAAAAGCAGCATTGT CGG (reversed) Intergenic
No off target data available for this crispr