ID: 1057895016

View in Genome Browser
Species Human (GRCh38)
Location 9:98902299-98902321
Sequence CAAGCTAACCAGGCATCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057895016_1057895018 4 Left 1057895016 9:98902299-98902321 CCTATAGATGCCTGGTTAGCTTG No data
Right 1057895018 9:98902326-98902348 TACTTTTTCACTATTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057895016 Original CRISPR CAAGCTAACCAGGCATCTAT AGG (reversed) Intergenic
No off target data available for this crispr