ID: 1057895940

View in Genome Browser
Species Human (GRCh38)
Location 9:98908673-98908695
Sequence CCGGACAGGGCCTTGTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057895932_1057895940 -4 Left 1057895932 9:98908654-98908676 CCTCGAGAGCGCCAGCCGCCCGG No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data
1057895930_1057895940 0 Left 1057895930 9:98908650-98908672 CCACCCTCGAGAGCGCCAGCCGC No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data
1057895928_1057895940 2 Left 1057895928 9:98908648-98908670 CCCCACCCTCGAGAGCGCCAGCC No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data
1057895926_1057895940 30 Left 1057895926 9:98908620-98908642 CCTGCTCTCGGTGGACAGCATCG No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data
1057895929_1057895940 1 Left 1057895929 9:98908649-98908671 CCCACCCTCGAGAGCGCCAGCCG No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data
1057895931_1057895940 -3 Left 1057895931 9:98908653-98908675 CCCTCGAGAGCGCCAGCCGCCCG No data
Right 1057895940 9:98908673-98908695 CCGGACAGGGCCTTGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057895940 Original CRISPR CCGGACAGGGCCTTGTGTTT AGG Intergenic
No off target data available for this crispr