ID: 1057896299

View in Genome Browser
Species Human (GRCh38)
Location 9:98911874-98911896
Sequence GCTGATAAGGAGTCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057896291_1057896299 24 Left 1057896291 9:98911827-98911849 CCGTGTGTCTCTGGGTGGGTACG No data
Right 1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG No data
1057896290_1057896299 25 Left 1057896290 9:98911826-98911848 CCCGTGTGTCTCTGGGTGGGTAC No data
Right 1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057896299 Original CRISPR GCTGATAAGGAGTCAGTGGC TGG Intergenic
No off target data available for this crispr