ID: 1057896299 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:98911874-98911896 |
Sequence | GCTGATAAGGAGTCAGTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057896291_1057896299 | 24 | Left | 1057896291 | 9:98911827-98911849 | CCGTGTGTCTCTGGGTGGGTACG | No data | ||
Right | 1057896299 | 9:98911874-98911896 | GCTGATAAGGAGTCAGTGGCTGG | No data | ||||
1057896290_1057896299 | 25 | Left | 1057896290 | 9:98911826-98911848 | CCCGTGTGTCTCTGGGTGGGTAC | No data | ||
Right | 1057896299 | 9:98911874-98911896 | GCTGATAAGGAGTCAGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057896299 | Original CRISPR | GCTGATAAGGAGTCAGTGGC TGG | Intergenic | ||
No off target data available for this crispr |